1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jenyasd209 [6]
3 years ago
13

How does the immune system and the integumentary system depend on one another?

Biology
1 answer:
Alex3 years ago
5 0

Answer: b.Nutrients collected by the immune system are carried throughout the body by the integumentary system

 

You might be interested in
Which of these associations is not correct? seed coat-ovary wall radicle-roots plumule-leaves cotyledons-stored food?
Mars2501 [29]

Seed coat-ovary wall association is not correct.

The seed coat originates from the maternal tissue, that is, the integuments. It is one of the three components of a plant seed, in supplementation to the embryo and the endosperm. The aim of the seed coat is to safeguard the seed from temperature-related, physical or water destruction. It is a protective outer covering of the seed.

On the other hand, the ovary wall refers to the wall of the ovary of a flower that ultimately develops into a pericarp or fruit wall.

8 0
3 years ago
Does a prokaryotic cell or a eukaryotic cell seem more simple? Explain our answer.​
dedylja [7]

Answer:

prokaryotic

Explanation:

I think that because since it doesn't have a nucleus or as many organelles as eukaryotic. They are smaller in size and don't have membrane bound structures.

6 0
3 years ago
List atleast 3 limiting factors that could impact the resources available for a population of lions.
Dimas [21]
Prey, water, and space
4 0
3 years ago
The force that causes air to move into and out of the lungs is supplied by
Elena L [17]
Ventilation is the act of moving/pushing air into and out of the lungs.
5 0
3 years ago
Cellular respiration is different than breathing because?
zmey [24]
B) it involves a chemical reaction.

Breathing is a part of physiologicalrespiration and functions to bring oxygen into the lungs and expel carbon dioxide. Cellular respiration is a chemical process by which energy is obtained within individual cells from biomolecules like glucose.
8 0
4 years ago
Other questions:
  • Factors that can increase mutation rates are _____.
    6·2 answers
  • Why should latex gloves be worn when preparing chromatography plates?
    14·2 answers
  • The major evolutionary split of protostome animals was based on the _____.
    14·1 answer
  • Which of the following is characteristic of ciliates? A. They can exchange genetic material with other ciliates by the process o
    5·1 answer
  • The head of a giraffe is 2.0 m above its heart and the density of the blood is 1.05 103 kg/m3. what is the difference in pressur
    14·1 answer
  • Which of the following is not a body system represented in the figure shown? (1 point)
    15·1 answer
  • Homeostasis is controlled by what feedback mechanism? how does it work?
    14·1 answer
  • Correct answer will be marrk as braineast answer​
    8·1 answer
  • Is bread cell organization
    14·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!