Answer:
4
Explanation:
2+2=4. It is a very complex equation. Hope this helps!
-Aslina
I'd say C. an allergic reaction. Mainly because lots of people are allergic to many things and many people intend to have seasonal allergies cause by plants. Hope it helps!
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer:
will be caught by specialised scales on the test
Explanation:
- Minnesota Multiphasic Personality Inventory (MMPI) is a test used to test the psychology for a person by assessing their psycho-pathology as well as their personality traits.
- MMPI-2 is one of its forms which consists of true/false questions.
- MMPI-2 has a total of 10 scales to test the 10 categories of abnormality associated with human behaviour along with 4 scales to test the validity of the test that is whether the person is giving the answers truthfully or not.
- Based on these scales, Mike will be caught faking his illness.
Long line fishing, drift nets, and trawling all produce an insignificant amount of by-catch is a false statement.
Explanation:
Bycatch fishing is "the incidental capture of non-target species” like sharks, dolphins, seabirds, marine turtles and other marine organisms while applying modern fishing gears like long line fishing, drift nets, or trawling.
Although, these inconspicuous modern fishing gears are highly efficient in catching the desired types of target fishes; these also catch significant amount of other marine species which travel along the line as a bycatch.
A huge number of exclusive marine fishes which are mostly under the endangered list and many juvenile fishes are caught as bycatch which are mostly thrown back dead overboard. Further these modern gears also endanger the marine structures like the coral reefs.
