1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Finger [1]
4 years ago
14

Which of the following types of communication is correctly paired with a substrate that usually uses that method of communicatio

n?
A. cortisol - endocrine

B. acetylcholine - autocrine

C. cytokines - synaptic

D. insulin-paracrine

E. glycine - direct cell-cell contact
Biology
1 answer:
dimulka [17.4K]4 years ago
5 0

Answer:

This question should be like which one of the following types of communication is not correctly paired with a substrate that usually uses that method of communication?

As this question contains many options that are correct so we can not chose one. I will provide answer and then its explanation.

The correct answers are following:

A. cortisol - endocrine

B. acetylcholine - autocrine

C. cytokines - synaptic

E. glycine - direct cell-cell contact

Explanation:

Answer: A. cortisol - endocrine

Explanation: There is a research paper in which they said that cortisol is a stress hormone which is released in endocrine system. This trigger the fight and flight response of system.

Reference: Breen, K. M., Billings, H. J., Wagenmaker, E. R., Wessinger, E. W., & Karsch, F. J. (2005). Endocrine basis for disruptive effects of cortisol on preovulatory events. Endocrinology, 146(4), 2107-2115.

Answer: B. acetylcholine - autocrine

Explanation: A research paper published in 2004 in which they demonstrated that Acetylcholine is released from autocrine system and help in signalling and communication.

Reference: Proskocil, B. J., Sekhon, H. S., Jia, Y., Savchenko, V., Blakely, R. D., Lindstrom, J., & Spindel, E. R. (2004). Acetylcholine is an autocrine or paracrine hormone synthesized and secreted by airway bronchial epithelial cells. Endocrinology, 145(5), 2498-2506.

Answer: C. cytokines - synaptic

Explanation: Francesca Romana Rizzo et al (2018) proved prof that cytokines are associated proper brain functions and neural synapse communication.  

Reference: Rizzo, F. R., Musella, A., De Vito, F., Fresegna, D., Bullitta, S., Vanni, V., & Centonze, D. (2018). Tumor necrosis factor and interleukin-1β modulate synaptic plasticity during neuroinflammation. Neural plasticity, 2018.

Answer E. glycine - direct cell-cell contact

Explanation: It is proved that glycine is a neurotransmitter that carryout cell to cell contact communication through neurons.

Reference: Cooper GM. The Cell: A Molecular Approach. 2nd edition. Sunderland (MA): Sinauer Associates; 2000. Signaling Molecules and Their Receptors.

You might be interested in
Rain cannot occur until ____?
lubasha [3.4K]

Answer:

A. the air becomes saturated with water vapor

Explanation:

The saturated water vapor air forms clouds ( nimbus clouds ) which hold that vapour at a low pressure

3 0
3 years ago
Read 2 more answers
What is the most common protein in the body
bekas [8.4K]
The answer you are looking for is Collagen.

Hope this helps!:)
6 0
4 years ago
Read 2 more answers
Which of the following energy is converted into chemical energy by the chlorophylls?
irga5000 [103]

Answer:

light energy

Explanation:

Plants take in sunlight given off by the sun to make food during photosynthesis

7 0
2 years ago
Read 2 more answers
The formation of clouds is caused by which of the following
iris [78.8K]
Condensation is the formation of clouds.
4 0
3 years ago
Which of the following is NOT a type of Arachaebacteria? halophile thermophile mesophile none of the above
ryzh [129]
I don't none of them are

I hope this helps!
3 0
3 years ago
Other questions:
  • Consider an atom of gold in which the nucleus contains 79 protons and 118 neutrons. What is its atomic number and atomic mass nu
    14·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is the genus and species of the animal that has retractable claws and is domesticated?
    5·2 answers
  • Where do most of the oceans animals and plants live in the ocean
    12·2 answers
  • Nitrous oxide dilutes the air a person breathes, depriving the individual of oxygen.
    12·2 answers
  • What is mucus and how is it helpful?
    10·2 answers
  • JND stands for:
    6·1 answer
  • Explain how water is used to create electricity.
    15·2 answers
  • Can someone help me I am stuck
    12·1 answer
  • During ____ the nuclear membrane around the nucleus begins to disintegrate
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!