<u>Answer:</u>
Food production system involves aspects of food such as principles of food processing and strategies to improve food and nutritional value for public, while <u>food system</u> is its application for the selection, preservation, processing, packaging, and distribution of safe foods.
<u>Explanation:</u>
- Food production system involves feeding population growth, packing, consumption, marketing, disposal, harvesting and food related items.
- It is also based on input need and output generated. All around the world countries are achieving sustainable development goals.
- Many countries plays key role in food system. They also achieve social economic goals by food system.
Western Europe has warmer weather.
I believe your answer is the year 2020
Answer:Lake Ara Shetan (Butajiri-Silti Volcanic Field)
1st O'a Caldera, with Lake Shala and the smaller Chitu water-filled maar
2nd Bilate River Volcanic Field (several water-filled maars)
3nd El Sod (small salt lake), South Omo Valley
Explanation: i no it
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
