Answer: Nervous system
Explanation:
The cerebellum of the brain is the structure of the nervous system known to control various muscles of the body that are involved in involuntary activities such as breathing.
Thus, the nervous system controls and regulates a person's breathing
Answer:
asking about subjective matters, addressing a gap in knowledge, and already having fully confirmed explanations
Explanation:
Answer:
immature ovulate
Explanation:
An ovulate cone will become a mature gymnosperm cone after all of the ovules mature into seeds.
Answer:
Increases (dont mind this it's to get past the letter minimum)
Explanation:
Your answer is increases
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
