1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ad libitum [116K]
3 years ago
7

What are ribosomes? What do they do.

Biology
2 answers:
Pani-rosa [81]3 years ago
8 0

Answer:

Function. Ribosomes are minute particles consisting of RNA and associated proteins that function to synthesize proteins. Proteins are needed for many cellular functions such as repairing damage or directing chemical processes. Ribosomes can be found floating within the cytoplasm or attached to the endoplasmic reticulum

miskamm [114]3 years ago
5 0
The ribosome is a complex molecular machine found inside the living cells that make proteins from amino acids in the process called protein synthesis or translation. ... Ribosomes are special organelles as they are found in both prokaryotic and eukaryotic cells. Every cell needs ribosomes to manufacture proteins.
You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
2 years ago
A mycorrhizal relationship in which the hypal filament does not penetrate the root cell, but grows around them is called?
sukhopar [10]

Answer:

Ectomycorrhiza

Explanation:

6 0
3 years ago
Explain why genes located more than 50 map units apart behave as if they are not linked.
OlgaM077 [116]
This is on account of every chromosome just has up to 50 units so when it surpassed this number it's on an alternate chromosome, along these lines it can't be connected. 
One can decide whether qualities are connected or not by taking a gander at the posterity and deciding the recombination recurrence you can do this by taking the aggregate number of posterity that were recombined and partitioning it by the aggregate
8 0
2 years ago
How could availability of food for the prey affect the number of predators?
defon
If the prey is not getting enough food, they will eventually die which affects the number of predators because then the predator species would also die
7 0
3 years ago
Frequently, a group of related species will each have a unique courtship ritual that must be performed correctly for both partne
Lesechka [4]
Behavioral Isolation
<span />
3 0
3 years ago
Other questions:
  • How is volume, temperature, pressure and density of gas related
    9·1 answer
  • In what type of reproduction do cartilaginous fish lay eggs?
    5·2 answers
  • When our sun is formed and what is happening in it right now.
    14·1 answer
  • Cladistics is a way of classifying organisms by examining the characteristics of their ancestors and descendants and depicting t
    5·2 answers
  • A heterozygote is an individual with:
    8·1 answer
  • Identify part A and C​
    13·1 answer
  • Define taxon ? give some example of taxon at different hierarchical level<br>please answe de do​
    15·1 answer
  • Which of the following statements is true of density? *
    15·1 answer
  • In order for our cells to metabolism N2 into 2NH3, a total of _____________ ATP is required.
    7·1 answer
  • 8. You have been asked to develop a safety plan
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!