All categories

3 years ago

The vestibular system is the only sensory system to send projection fibers directly to the cerebellum.

Biology

1 answer:

Greeley [361]3 years ago

3 0

Answer: False

Explanation:

The above statement is false as, cerebellum receives the projection fibers from the other sensory system in which they are received in the different part of cerebellum. As, the cerebellum received the information from the sensory system and the spinal cords and also in the other part of the brain as it regulates in the movement of the motor.

You might be interested in

How can the biogeochemical cycle help a ecosystem

san4es73 [151]

It influences the rates at which organisms grow and reproduce.

4 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago

After completing 10 years of experimentation, a scientist reports a new scientific law about the movement of sand on beaches. Ho

Setler [38]

Experimentation (or the experiments the scientist was doing for 10 years) could be wrong or done in an inappropriate way. The only way to know if the information is valid is by checking the way the experimentation (data) was done as well as making sure to check all other factors

7 0

2 years ago

Which term describes a chemical reaction in which water is gained?

lukranit [14]

The term that is used to describe a chemical reaction in which water is produced or gained I believe is Dehydration Synthesis.

3 0

3 years ago

Read 2 more answers

Firewood is made up of cellulose, which is a polymer of glucose molecules. When burning, heat and light are given off, indicatin

skelet666 [1.2K]

Answer:

Exergonic reaction

Explanation:

A chemical reaction which is associated with a release of energy and thus, is associated with a negative free energy change is said to be an exergonic reaction.

An exergonic reaction owing to the negative free energy change is a spontaneous reaction.

The energy that is released in the exergonic reaction is usually observed in the form of heat and light.

The energy is released due to the breaking of the chemical bonds.

Therefore, on burning of the firewood the bonds between the glucose molecules break up which leads to the release of energy in the form of heat and light and this is thus, an example of an exergonic reaction.

7 0

3 years ago