1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juliette [100K]
3 years ago
10

What is the seed pod of the cotton plant called?

Biology
1 answer:
____ [38]3 years ago
7 0
Is called the cotton Boll. Hope this helps:)
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Where is the mRNA made?​
Arlecino [84]

Answer:  mRNA is made in the nucleus

Explanation:

3 0
3 years ago
All of the following chemical reactions are double replacement reactions EXCEPT
damaskus [11]
C is a combustion reaction 
5 0
2 years ago
Unequal pupils most likely indicate what type of injury?
Ganezh [65]
Hi unequal pupils would likely indicate a brain injury.
Hope this helps.
4 0
2 years ago
(will give sna p and brainiest) Why does the Amazon River not create deltas?
Lady_Fox [76]

Answer:

"The ocean currents are too strong by the Amazon River to form deltas."

Explanation:

The ocean currents carry away sediment in the river before it can settle and form a delta.

4 0
2 years ago
Read 2 more answers
Other questions:
  • Help me for the last question
    14·1 answer
  • When working in an environment or with patients who are culturally different, a medical assistant should A. separate personal be
    5·1 answer
  • 5 bags with baseballs in them that weigh 21.56 if each bag weighs the same, how much does each bag weigh
    11·2 answers
  • Explain the process of cellular respiration. list the raw materials and products of this process. tell how the body eliminates t
    10·1 answer
  • Describe the benefits to using tissue cultures to study medications used for treating cancer cells.
    9·2 answers
  • Can you identify the genotype of a person with normal melanin? why or why not?
    11·1 answer
  • How are plants classified?
    14·2 answers
  • Why does a carrot feel spongy after being soaked in salt water?​
    6·1 answer
  • Water can act as a blank or a blank
    13·1 answer
  • Which of the following is NOT a function of receptors?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!