1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksklad [387]
3 years ago
12

In Figure 12–5, what nucleotide is going to be added at point 2, opposite from guanine?

Biology
2 answers:
Luden [163]3 years ago
3 0
Cytosine is the answer
posledela3 years ago
3 0

Answer:

1. Adenine

2. DNA Polymerase

Screenshots below

Explanation:

You might be interested in
Action potentials in the heart spread from cell to cell through
Leni [432]

Answer:

Gap junctions within the intercalated disks

Explanation: Gap junctions within the intercalated disks allow impulses to be propagated from one cardiac muscle cell to another. It allows sodium, potassium, and calcium ions to flow between adjacent cells, propagating the action potential, and ensuring coordinated contractions.

8 0
3 years ago
In 1977 the Richardson family, tired of the congestion and crime associated with urban life, moved from their townhouse located
PtichkaEL [24]
Urbanization is the term that describes the Richardson family, who was tired of the congestion and crime associated with urban life, and then moved from their townhouse located in the middle of the city<span>to the suburbs</span>
4 0
3 years ago
Read 2 more answers
Explain the connection between the beginning of life and the universal genetic code
GaryK [48]

The connection between the beginning of life and the universal genetic code is that they all started with a simple one celled molecule. The Universal genetic code is a common language for almost all organisms to translate nucleotide sequence of deoxyribonucleic acid that is DNA and ribonucleic acid that is RNA to amino acid sequences of proteins. All living Organisms have a genetic code generally represented by the sequence of nucleotides in their DNA.

8 0
3 years ago
Imagine that you are studying the food preferences of a lizard species across its range. you have hypothesized that because thes
Llana [10]
The lizards have to adapt to the environment to survive. The lizards may have always ate flies/lizards but once they reached the environment that produced opposite of their eating habits, they altered their eating habits. The lizards' adaptation will give them the ability to survive within the said environment that produce certain foods. 
6 0
3 years ago
What MOST likely happens to soil when crops are NOT rotated from year to year?
Amiraneli [1.4K]
The nutrients in the soil will increase resulting in healthier crops.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Why does changing the pH of a solution affect the ability of an enzyme to catalyze a chemical reation?
    10·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which would make for a weak claim?
    10·2 answers
  • Joe Tourist and his family leave for Dallas , a distance of 177 miles. They arrive in Dallas 12 hours later because they stopped
    9·1 answer
  • Study the picture of the birds. These birds are all types of birds found in the islands of Hawaii and they all evolved from a co
    15·2 answers
  • A key feature of animal body plans is that they can show multiple types of symmetry. For example, a dog would represent bilatera
    5·2 answers
  • I need helppp please
    6·1 answer
  • A key prediction/implication of evolutionary theory is that:
    11·1 answer
  • Three body cells in the human body which is attacked by the plasmodium parasite​
    15·1 answer
  • Which of these is not a principle of natural selection?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!