1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
15

According to some scientists, which is a cause of global warming?

Biology
2 answers:
maria [59]3 years ago
8 0

Changes in solar energy i got a 100%

tigry1 [53]3 years ago
5 0

Most climate scientists agree the main cause of the current global warming trend is human expansion of the "greenhouse effect" — warming that results when the atmosphere traps heat radiating from Earth toward space.Life on Earth depends on energy coming from the Sun. About half the light reaching Earth's atmosphere passes through the air and clouds to the surface, where it is absorbed and then radiated upward in the form of infrared heat.

You might be interested in
In developed nations, which nutrients are most apt to be lacking in a child's diet?
yKpoI14uk [10]
I believe that in developed nations, the nutrients that are most lacking in a child's diet are the; calcium, iron and zinc. Zinc is needed for the activity of more than 100 different enzymes in the body and plays a role in the immune function. It aids in the maintenance of healthy immune function in kids and may reduce the frequency of mild upper respiratory tract infections. Calcium keeps the bones healthy and teeth thus supporting the skeletal structure and function. Iron is an important component of hemoglobin.
7 0
3 years ago
The N-H bond in ammonia is polar because
Masteriza [31]

Answer:

E: nitrogen is much more electronegative than hydrogen.

Explanation:

in paulings scale hydrogen is 2.1 and nitrogen is 3...so

nitrogen is much more electronegative than hydrogen.

3 0
3 years ago
Read 2 more answers
Light waves
nikklg [1K]
Hello,

I believe you're asking which option is true. If so, A) do not require a medium. Unlike mechanical waves, electromagnetic (or light) waves do not require a medium. It has been proven that light travels in a straight line. Light waves are, in fact, electromagnetic radiation, and they can travel in a vacuum. 


Faith xoxo
8 0
3 years ago
Read 2 more answers
Select the organs that are a part of the respiratory system.
denpristay [2]

Answer:

Nose, Pharynx, Larynx, Tracha, Bronchi and Lungs

7 0
3 years ago
Describe the role of nuclear fusion in the life cycle of a star.
castortr0y [4]
It’s the source of all the energy from all the stars ... until their fuel is used up
7 0
3 years ago
Other questions:
  • Similar to a hurricane only weather ?
    8·1 answer
  • Which gas supplies the energy for storms
    7·1 answer
  • What abiotic factors have people changed
    13·1 answer
  • Think of a chemical or material inside the human body that would be synthesized within bacteria what would be the potential bene
    5·1 answer
  • What best describes the nature of cellular respiration?
    8·1 answer
  • The main elements of organic compound is
    5·2 answers
  • Based on the simulation, write a definition for the term “balanced chemical equation.”Based on the simulation, write a definitio
    6·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Question 2 (1 point)
    11·1 answer
  • Doj-mrkm-hcv join now fast​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!