1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
3 years ago
9

Which of the following best explains why herring gull chicks were one of the first species to exhibit the effects of pollution,

according to the figure?
A.
Toxins increase in concentration as one moves up a food chain.

B.
Toxins have less of an effect on herring gulls than on other species.

C.
Toxins affect terrestrial organisms more severely than aquatic organisms.

D.
Toxins decrease in concentration as one moves up a food chain.
Biology
1 answer:
prohojiy [21]3 years ago
6 0
The correct answer is A.
Toxins and various pollutants increase in concentration through the food chain in a process called biomagnification. This means that the organisms on the top of the food chain, like the herring gull, have many times greater concentration of toxins than the lower food chain level organisms because they prey on lower food chain level organisms. If a herring gull ears 100 herrings, it will have a 100x times greater concentration of toxins in its body than a herring.
You might be interested in
PLEASE HELP!!!
katrin2010 [14]

Answer:

A:1 only.

Explanation:

In order for a nuclear power plant to be decommissioned safely, components have to be taken apart and cleaned to reuse in a different location.

5 0
1 year ago
What's the relationship between photosynthesis and cellular respiration?
Maru [420]
Both are exchange of gases in plants ! some differences are ....

1) respiration takes place all the time while photosynthesis happens only in the presence
of sunlight !

2) in respiration O2 is used but in photosynthesis CO2 is used !

3) starch breaks to give energy in respiration but in photosynthesis starch is formed !
3 0
3 years ago
If the wild-type codon is ggu, how many single-base substitutions will result in an amino acid substitution? include any changes
SashulF [63]

Answer:

Approximately six

Explanation:

The codon GGU

Single base substitution that will change this codon that codes for glycine to another amino acid includes: a single base substitution in the GGU codon such as GGU- AGU can occur. thus, approximately six single base substitution can take place to change this codon to code for another amino acid. A single base substitution cannot change the codon to a stop codon unless it happens twice or there is more than a single base substitution.

4 0
2 years ago
What enzyme allows a retrovirus to make dna from an rna template?.
Zolol [24]

Answer:

Retroviruses or reverse transcriptase

Explanation:

Retroviruses are viruses in which the genetic material consists of ribonucleic acid (RNA) instead of deoxyribonucleic acid (DNA). Retroviruses produce an enzyme known as reverse transcriptase that uses RNA as a template to manufacture DNA, which can then be permanently integrated into the DNA of the infected host cells.

Hope this helps please mark brainliest :)

6 0
2 years ago
Read 2 more answers
I need help please ​
Temka [501]

Answer:

75 percent, 25 percent

Explanation:

5 0
3 years ago
Other questions:
  • A student sets up an experiment and wants to see if different amounts of fertilizer affect the growth of basil. They place 4 sep
    12·1 answer
  • Why do plant cells need chloroplasts? Explain.
    7·2 answers
  • When an organism of many cells breaks up into two or more parts and these parts survive to produce a new organism, reproduction
    10·2 answers
  • Which of the following is the main energy source for our sun?
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • When is an animal most likely to enter into dormancy (hibernation kestivation)?
    10·1 answer
  • The most effective way to protect groundwater resources is to ____.
    7·1 answer
  • Which coated vesicles move materials in a retrograde direction from the ERGIC and Golgi stack backwards toward the ER?
    15·1 answer
  • What are weeds??????​
    9·1 answer
  • Classify each description with the correct type of electromagnetic radiation.
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!