To prove that a certain fruit (in this case, an orange) indeed contains a certain compound (in this case, vitamin C); then the vitamin C should be extracted and isolated from the orange and must be confirmed by molecular analysis. The extraction process involves using chemicals (i.e. 6% MPA), and procedures such as centrifugation and filtration. Then the extract is stored and subjected to high-performance liquid analysis (HPLC) to measure the vitamin C content.
Force, distance, and time will
Determine power
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
c
Explanation:
Most DNA is located in the cell nucleus (where it is called nuclear DNA)
Answer: B. by toxic chemicals (in smoke) or radiation that can damage the DNA in cells.
Explanation:
The carcinogens presents in cigerates covalently bind to DNA and form DNA adducts which results into miscoding (e.g., insertion of the wrong base) during replication of DNA and this genetic mutation causes uncontrolled cellular growth which causes cancer.
Ionising radiation including X-rays, radioactive particles, and gamma rays,can cause cancer by damaging DNA. high-energy radiation damages DNA and cause genetic mutation same as cigerates and causes cancer.
Both toxic chemicals (in smoke) or radiation damages DNA inthe cells which leads to cancer.
Hence, the correct option is B.
