1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Liono4ka [1.6K]
3 years ago
6

Amphibians, such as frogs, have adapted to have thin, very permeable skin that is well supplied with blood vessels. How does thi

s adaptation most likely help amphibians survive in aquatic environments?
A. It allows them to maintain fairly stable internal temperatures.
B. It allows them to absorb nutrients directly from their environment.
C. It allows them to release chemicals into their environment to attract mates.
D. It allows them to take in oxygen and release carbon dioxide through their skin.
Biology
1 answer:
jarptica [38.1K]3 years ago
7 0

Answer:

to allow easier gas exchange

Explanation:

You might be interested in
How could you prevent the contamination of the phosphorus cycle?
VashaNatasha [74]
You could prevent it by not seeing it as much
8 0
3 years ago
Neither end of Earth’s axis is tilted toward or away from the sun.
kotykmax [81]
Toward the sun because it faces us and that is how we get heat and live
3 0
3 years ago
You need to use the scientific method and<br> In order to work as an environmental scientist.
adell [148]

Answer:

You need to use the scientific method and <u><em>knowledge of the environment </em></u>in order to work as an environmental scientist.

Explanation:

An environmental scientist should have an excellent knowledge about the systems of the environments and scientific methods. If a scientist is thorough about his understandings of the environment, he will be able to recognize any changes in the environment immediately and formulate the necessary reasons for the changes by using the scientific method of research. By using the scientific method of research, a scientist is able to learn about the various phenomenon occurring in the environment.

6 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
How would homeostasis be affected if the cardiac muscle stopped contracting?
vodka [1.7K]

The heart is a muscle, therefore, if the cardiac muscles stopped contracting, the result would be the ceasing of heart function. That would lead to death, as blood wouldn't be pumped throughout the body. Homeostasis would therefore be interrupted.

4 0
3 years ago
Other questions:
  • Which example describes an acquired trait that cannot be determined by looking at an individual?. . A.. skin color. . B.. body s
    9·2 answers
  • How many Barr bodies would be present in white blood cells of an individual of Jacobs Syndrome, XYY? g
    5·1 answer
  • The walls of blood vessels have two layers of smooth muscle. One layer is lengthwise and the other layer is around the circumfer
    13·1 answer
  • What are some of the possible consequences (effects) or shon<br>ecological change?<br>​
    12·1 answer
  • Which base pairs would be found in a cell?
    13·1 answer
  • Audrey woke up and decided to go to the bakery for breakfast. When she walked through the door, the smell of blueberry muffins c
    15·1 answer
  • Boredom, defensiveness, and hostility are __________ symptoms of stress.
    13·1 answer
  • Explain what asexual reproduction is and list the 5 different types that exist.
    7·1 answer
  • What are the four parts of a conclusion​
    12·1 answer
  • Hello people ~
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!