1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisabon 2012 [21]
4 years ago
13

The “box” part of a box-and-whisker plot represents __________.

Biology
1 answer:
Inga [223]4 years ago
5 0
<span>quartile values..................</span>
You might be interested in
What nutrient do erythrocytes use to stay alive in a blood collection tube filled with blood?
belka [17]

what are the options?

7 0
4 years ago
Read 2 more answers
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
Which of the following food chains is in the correct order?
sasho [114]
C is the correct answer because 

1. producer creates its own food
2. consumer eats producer so it gets energy
3. consumer or producer die giving way for decomposers 
<span />
5 0
3 years ago
The clownfish is a species of fish that lives between the stinging tentacles of sea anemones. The clownfish protects the anemone
Anna71 [15]
Mutualism because they are both benifiting
7 0
3 years ago
I need help with this ASAP please!!!
Sati [7]

Answer:

A = water

B= Glucose

C = Oxygen(O2)

Explanation:

7 0
3 years ago
Other questions:
  • The condition of “capture” refers to the extreme closeness that can occur between what two entities?
    12·1 answer
  • Which change in the environment would have a negative effect on the survival of a species in an ecosystem
    12·2 answers
  • Which of the following is a group of cells chosen to perform an action?
    15·1 answer
  • Why and How is Photosynthesis like a Recipe?
    9·1 answer
  • Which of the following statements concerning carbohydrates associated with the plasma membrane is correct? (eText Concept 7.1)
    11·1 answer
  • In which part of the plant cell does turgor pressure occur
    10·1 answer
  • Assuming that you had an agonist and an antagonist for every autonomic transmitter receptor, how could you determine which recep
    9·1 answer
  • What is the name of the enzyme used to make rna nucleotides
    15·1 answer
  • In a shady forest what do plants mainly compete for
    13·2 answers
  • Nitrogen fixing bacteria and nitrifying bacteria convert atmospheric nitrogen into different compounds of nitrogen.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!