1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
igomit [66]
3 years ago
15

Coral reefs are essential for the survival of other organisms

Biology
1 answer:
SCORPION-xisa [38]3 years ago
4 0

she need the essential for survival from other organisms to live


You might be interested in
The answer to the problem
chubhunter [2.5K]

plz expand image ; )


4 0
3 years ago
Produce three small cells that
Anton [14]
The answer is e. ovules
6 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
An individual has a genotype of IBi. What is their blood type?
abruzzese [7]

Answer:

type B

.................

4 0
2 years ago
Looking at the Punnett square, what are the possible genotypes and frequencies
Rom4ik [11]

Answer:

50% or 1/2 of the children will be heterozygous.

50% or 1/2 of the children will be recessive hom0zygotic.

Explanation:

7 0
3 years ago
Other questions:
  • Which terms below are associated with communication between neurons?
    10·2 answers
  • In stressful situations, people with an antisocial personality disorder show _____________ when compared with people unaffected
    14·1 answer
  • What are the conditions required for natural selection? Check all that apply.
    12·2 answers
  • Please help! Will give Brainliest!
    13·2 answers
  • 1. Which explains why hydroelectric power has a limited future in the United States?
    13·1 answer
  • Which macromolecule is the body's first source of energy and is made up of our top 3 elements?
    13·1 answer
  • Prokaryotes
    10·1 answer
  • ¿cual es el porcentaje de timina del total de las bases nitrogenadas del ADN
    7·1 answer
  • The chemical energy is stored in the form of what?
    12·1 answer
  • Can you help me (only used these terms)
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!