1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovikov84 [41]
3 years ago
15

Which values are equivalent to the fraction below?

Biology
1 answer:
Vilka [71]3 years ago
8 0

a.) 1/16

this is because 2^5/2^9 is 32/512, which simplifies to 1/16.

You might be interested in
2. A man with type B blood marries a woman with type A blood. Their first child has type o blood. The couple says this is
Ket [755]
A) it is possible if they both have the recessive O type
8 0
3 years ago
Read 2 more answers
Zero population growth occurs when a population has the same number of individuals entering the population (births) as those lea
horrorfan [7]

The year in which the deer population closest to ZPG is in 1971

That year the population of deer closest to Zero population

<h3>Living organisms </h3>

Living organisms; be it plants or animals are any organic or living system composed of cells and function as an individual entity.

  • All living organisms share a number of key characteristics or functions such as movement, respiration, homeostasis, reproduction, growth, evolution, competition and others.

  • Animals and plants also posess systems such as the digestive, skeletal, transport, nervous, excretory, respiratory and reproductive system.

  • Living organisms are also taxonomically classified as either unicellular microorganisms or multicellular plants and animals

So therefore, the year in which the deer population closest to ZPG is in 1971

Complete question:

Zero population growth occurs when a population has the same number of individuals entering the population (births) as those leaving the population (deaths). In which year, was the deer population closest to ZPG?

Learn more about living organisms:

brainly.com/question/17259533

#SPJ1

8 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
The lab that tested the water initially determined that the water quality grew worse between 2005 and
Svetlanka [38]

Answer:

Most water systems test for lead as a regular part of

water monitoring. These tests give a system-wide

picture, but do not refl ect conditions at a specifi c

household faucet.

If you want to know if your home’s drinking water

contains unsafe levels of lead, have your water tested.

Testing is the only way to confi rm if lead is present or

absent.

Some faucet and pitcher fi lters can remove lead from

drinking water. If you use a fi lter to remove lead, be

sure you get one that is certifi ed to remove lead by NSF

International.

7 0
3 years ago
Denning is another word to use for hibernation. Bears, like the black bears seen here, den during the winter because A) it is ve
alekssr [168]

Answer:

A

Explanation:

When the cold hits there noise and senses it triggers the sleep mode

4 0
3 years ago
Read 2 more answers
Other questions:
  • Explain how a paleontologist might use absolute dating techniques to determine the age of a fossil.
    14·2 answers
  • Calculate the osmotic pressure of a solution containing 19.15 mg of hemoglobin in 15.4 mL of solution at 29 ∘C . The molar mass
    6·1 answer
  • 15. Antidiuretic hormone (ADH) functions at the cellular level by
    14·2 answers
  • How does solid rock become soil
    6·1 answer
  • You are studying the effects of specific transcription factors on the activation of gene expression. You notice that one particu
    8·1 answer
  • how many kingdoms of life are in this graph and what group does not belong in any of the kingdoms help it’s due soon
    8·1 answer
  • Which of the following choices did Wegner give as evidence for continental drift?
    13·1 answer
  • The light reactions can only occur in the absence of light.<br> A. True<br><br> B. False
    9·2 answers
  • Drag each label to the correct location. Not all labels will be used.
    10·1 answer
  • Which codon in the sickle cell DNA is altered: 1st , 2nd or 3rd
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!