1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WITCHER [35]
3 years ago
12

Name two nutrients that are recycled through an ecosystem.

Biology
2 answers:
lbvjy [14]3 years ago
8 0

Answer:

oxygen and phosphorus

Explanation:

i took the thing

Oliga [24]3 years ago
7 0

Answer:

1) Oxygen 2) Phosphorus

Explanation:

You might be interested in
In photosynthesis, the electron that travels through the electron transport chain in the thylakoid membrane comes from____1____
Step2247 [10]
Answers:
1) Water
2) NADH

--------

1) Water donates the initial electron in photosynthesis. The process of photolysis splits the water into H+ and O2 (oxygen, a byproduct of photosynthesis), and releases electrons which are taken up by photosystem II.

2) The electron transport chain is in the last step of cellular respiration, oxidative phosphorylation. NADH donates the electrons, which are used to pump H+ against the gradient into the intermembrane space of the mitrochondria. These H+ flow back across the membrane through ATP synthase to generate ATP.

3 0
4 years ago
20 POINTS AND BRAINLIEST FOR BEST ANSWER.
slega [8]

Genetic information is your DNA, other known as deoxyribonucleic acid. It is basically your identification.

Genetic information (DNA) helps you know and understand health conditions that run in your family, as well as your risk for developing certain health conditions or having a child with certain conditions. This information can help you make healthy lifestyle choices and important life and medical decisions.

It can also be used to identify a perpetrator in a crime. There are many uses for DNA.

If this is not enough, feel free to use this link to learn more about DNA: https://en.wikipedia.org/wiki/DNA

7 0
4 years ago
Why is diffusion important to biology?
Stella [2.4K]
Diffusion is important because: 
<span>a) the human cell can obtain nutrients and gases </span>
<span>b) excrete metabolic wastes </span>
<span>c) maintain a suitable pH and ionic concentration within the cell for enzyme activity. </span>
6 0
3 years ago
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
erica [24]

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
5 0
3 years ago
In an ecosystem what form does carbon take after photosynthesis
melisa1 [442]

Answer:

Photosynthesis by land plants, bacteria, and algae Transforms carbon dioxide or bicarbonate into organic molecules.

Explanation:

6 0
3 years ago
Other questions:
  • Choose the phrase that completes the passage. When Harrison is walking home from work, he is accosted by a group of teens. Harri
    14·2 answers
  • I need structural and behavioral adaptations, can someone explain how I find some or give me examples?
    5·2 answers
  • Which of these statements is a scientific question that might be asked about
    11·2 answers
  • Conclude Assess what kinds of traits make invertebrate such a diverse group of animals.
    7·2 answers
  • What role does an enzyme play when the body processes sucrose into glucose and fructose
    5·1 answer
  • Which event occurs during meiosis that increases genetic variation and contributes to the process of
    8·1 answer
  • Put the following steps of the water into the correct order
    6·1 answer
  • give This question a shot and I’ll give you brainliest no links posted on My question or I will report you
    15·2 answers
  • What is human reproductive system<br><br>can you send diagram ​
    11·2 answers
  • in my investigation, i saw that it can cause the growth of algal blooms which can be toxic to wild life and humans. this could a
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!