1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ludmilkaskok [199]
3 years ago
9

How is the positioning of the frog's eye an adaptive advantage for the frog?

Biology
1 answer:
grandymaker [24]3 years ago
6 0
It allows it to hide under but still be able to see above it to catch flies
You might be interested in
The four gas giants are
AnnyKZ [126]
Jupiter, Saturn, Uranus, and Neptune
7 0
3 years ago
Read 2 more answers
Which perspective most clearly focuses on how we learn observable responses? a psychodynamic b humanistic c evolutionary d biolo
IgorC [24]
The answer is C. Evolutionary
5 0
4 years ago
Read 2 more answers
In two or more sentences, analyze why internal fertilization is more efficient than external fertilization?
almond37 [142]

Answer:

Although more offsprings are produced by the process of external fertilization but the process of internal fertilization is more efficient as compared to external fertilization. This is because, in external fertilization, it is more difficult for the sperm to find the egg and fertilize it. Even after fertilization, it might be that the zygote gets eaten up by a predator. There are none such risks in internal fertilization. The zygote is protected during the internal fertilization which makes this process more efficient.

5 0
3 years ago
Why does DNA replication need to occur?
Pani-rosa [81]
Long answer short- to reproduce cells.
5 0
4 years ago
Please help ! Has to be a complete sentence
mariarad [96]

Answer:

Explanation:

The red line is growing becuse the temputer is grtting hotter than everything else

3 0
3 years ago
Other questions:
  • Energy constantly flows into the biosphere as sunlight. this energy flows through organisms and the environment and eventually f
    5·2 answers
  • What properties DO NOT require a tool?
    12·1 answer
  • A scientist adds colchicine, a microtubule polymerization inhibitor, to a cell entering mitosis. At metaphase, the chromosomes o
    7·1 answer
  • a rock is dropped from a height of 60 m and is in free fall. What is the velocity of the rock as it reaches the ground 3.5 secon
    11·1 answer
  • Can you give me a long list of stinging insects
    5·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Two species of birds try to eat from the same ear of corn in a field, this is an example of
    14·1 answer
  • What are found in the nucleus of an atom?
    14·1 answer
  • Which of these is NOT a reason for mitosis in humans?
    8·2 answers
  • Which of the below features was not used to identify the early Homo distinction from Australopithecines
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!