High salinity, high temp, or D because of the salt which would cause humidity, which in turn would cause water
Mutualism, they both help each other out and both benefit
Autografts are skin grafts from the own patient, so the skin will not be recognized as a foreign substance, and there is no chance that the body will reject the cells.
The right option is; Absorption
Transport of a substance from the lumen (cavity) of an organ into one side of a cell and out the other side of the cell into the ecf is called absorption.
Absorption is the process of assimilating substances into cells or through the tissues and organs. Absorption is done through osmosis or diffusion. Absorption of substances takes place within the body such as the absorption of drugs into the bloodstream, and the absorption of nutrients by the digestive system.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
