1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wolverine [178]
3 years ago
7

Which statements describe why organisms are classified? Check all that apply.

Biology
2 answers:
stepan [7]3 years ago
6 0

Which statements describe why organisms are classified? Check all that apply.

1. Classification shows how closely related organisms are to each other.

2. Classification makes organisms easier to study.

3. Classification allows for better identification of new organisms.

The grouping system makes it easier for scientists to study certain groups of organisms.

Sergeeva-Olga [200]3 years ago
5 0

Answer:

Classification of organisms into different categories and levels of hierarchy, is all based upon the different features and properties of the living beings. As there are different techniques through which the different living organisms are classified into group or level of ecosystems. The different organisms are classified in such a manner that the professional and the students are very easy way to understand the different natural phenomenons.

  • <u>Phenotype:</u>

As the different phenotypical properties include the skin texture of the organism and the facial composure of the organisms.

  • <u>Genotypes or genetic data of the organism:</u>

The specie or the organism is classified on the basis of the different genetic  materials of the same organism, and the different genetic materials are evolved from time to time which is also then termed as the evolution inside the organisms body.

  • As, each of the organism is comprised of different properties and each of the organism is then studied easily by the different professionals and the students in a more method form of study.
  • While, most of organism are very closely related and the organisms which can produce an offspring like there own are termed as species, and most of the species are placed in the same genus of organisms having much similarities among them as they are placed in the same genus of animals or we can say organisms.Then they are in turn placed in a separate
  • While the most basic or we can say top most classification of the living organisms is done on the basis of there domain. But, however this whole classification of beings is termed as the field of taxonomy in simple terms.

You might be interested in
What are the 2 main groups of the nervous system (type the whole name)? What is the major
VLD [36.1K]
The central nervous system and the peripheral nervous system
6 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
The disorder characterized by cells dividing uncontrollably within the body is called
Tems11 [23]
C i believe bc cancer is characterized by uncontrolled cell division
7 0
3 years ago
Read 2 more answers
Which of the following formed from the remains of plants and animals that died millions of year ago?
Drupady [299]
Coal from swamp plants that formed millions of years ago.
3 0
3 years ago
Read 2 more answers
Passive transport move molecules without
Whitepunk [10]

Answer:

Passive transport moves molecules without energy

Explanation: hope this helps plz make brainlist

7 0
3 years ago
Other questions:
  • What is a complex protein-iron compound in blood that carries oxygen to cells?
    6·1 answer
  • Describe and draw the structure of an ATP module.
    9·1 answer
  • A fertilized egg usually implants itself and develops in the _____. a fertilized egg usually implants itself and develops in the
    12·2 answers
  • What do aids effect in the body of the cell
    9·1 answer
  • A strand of DNA contains the bases adenine, cytosine, cytosine, and guanine, in that order. What would be the order of the bases
    10·1 answer
  • List at least one freshwater ecosystem with moving water and one with standing water.
    10·1 answer
  • The role or way of life of a species within a community is its
    11·1 answer
  • Which of the following answer choices is not a valid type of mrna editing that occurs during the process of transcription?
    6·1 answer
  • Which of the following statements concerning chromosomal distribution is INCORRECT?
    11·1 answer
  • I need help with both of these questions
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!