1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liq [111]
3 years ago
7

You exhale about .0800 liters of CO2 (carbon dioxide) gas in a single breath. 22.4 liters of CO2 contain 6.022 x 1023 molecules.

6,022 x 1023 CO2 molecules have a mass of 44.0 grams. Find the A) number of carbon dioxide molecules you exhale in each breath. Find the mass of the CO2 you exhale in a single breath.
Biology
1 answer:
Ilya [14]3 years ago
3 0

Answer:

A) 2.150 * 10^{22}

B) 1.57 grams

Explanation:

Given -

Amount of gas exhaled in one single breathe = 0.080 liters

22.4 liter of carbon dioxide contains 6.022 * 10^{23} molecules

One liter of carbon dioxide contains = \frac{6.022*10^{23}}{22.4}\\= 2.688 * 10^{23}

A) Number of molecules in 0.08 liter of carbon dioxide = 0.08 * 2.688 * 10^{23}\\= 2.150 * 10^{22}

B) Mass of 6.022 * 10^{23} molecules is equal to 44 grams

Mass of one molecule = \frac{44}{6.022*10^{23}} \\= 7.306*10^{-23}\\

Mass of molecule is[tex]7.306*10^{-23} * 2.150 * 10^{22}\\= 1.57\\[/tex]  gram

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Which of the following determines the volume of a gas
charle [14.2K]
D! Because a gas takes its form and volume of its container
8 0
3 years ago
What is a colloid solution?
ZanzabumX [31]

Answer:

Colloids or colloidal solutions are mixtures in which microscopically dispersed insoluble particles of one substance are suspended in another substance. The size of the suspended particles in a colloid can range from 1 to 1000 nanometers (10-9 meters).

Hope it helps........

8 0
2 years ago
The open ocean is relatively nutrient poor. It is even referred to as a nutrient desert. What is another term for the open ocean
Contact [7]

Answer:

pelagic zone they

Explanation:

there are little to no nutrients to be used in these 5 biomes where as benthic zones have a surplus of nutrients in the sediment and soil under the sea

5 0
2 years ago
In some flowers, the ovary is hidden deep within the base of the flower while the pollen is held up in the air, often near a sou
kotegsom [21]
Igfed if we can get the one we e do have to do it again next time
7 0
2 years ago
Read 2 more answers
Other questions:
  • Why are internal membranes important for eukaryotic cells?
    9·2 answers
  • Where is the abdominal muscle that can only compress the abdomen?
    8·1 answer
  • What 6 things make earthquakes destructive?
    5·1 answer
  • 6. The skeletal structure shown would be classified as part of which of the following?
    14·2 answers
  • What does natural selection cause?
    14·2 answers
  • What type of fossil fuel is made from trees, ferns, mosses, and other marsh plants?
    13·2 answers
  • What is the function of the electron transport chain in each. Photosynthesis and Respiration.​
    10·1 answer
  • Increase the mutation rate with radiation or chemicals.
    9·2 answers
  • Using the Gizmo, create a fruit fly with the correct genotype. Explain how you did it
    15·1 answer
  • Which of the following is NOT true regarding the endocrine system?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!