1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAXImum [283]
3 years ago
6

Which of the following types of volcanoes has steep sides with a broad, gently sloping base?

Biology
1 answer:
lakkis [162]3 years ago
8 0
Composite-cone, a conical volcano built up by many layers of hardened lava, tephra, pumice, and volcanic ash.
You might be interested in
What's the complimentary DNA strand for A G G C T T A C A T T C G G T
alexira [117]

Answer:

TCCGAATGTAAGCCA

8 0
3 years ago
Imagine a scientist finds the fossils of an extinct Ichthyosaur and finds this morphological similarity of Ichthyosaurs and mode
ollegr [7]

Answer:

The correct answer is - Take blood samples and use DNA evidence to determine a more complete phylogenetic tree .

Explanation:

Scientists could not use DNA evidences to make a complete phylogenetic tree of Icthyosaur as there are no blood samples or other DNA molecules to create DNA printing or mapping to create phylogeny with the modern dolphins. They only can be make similarities based on the morphological characteristics of these two groups.

Thus, the correct answer is - Take blood samples and use DNA evidence to determine a more complete phylogenetic tree .

3 0
3 years ago
Light rays pass through the ______________, which opens or dilates in darkness and closes or constricts in brightness. The image
irina [24]

Answer:

The correct answer will be-

1. Pupil

2. Retina.

Explanation:

Organisms are able to see the world around them thorugh the sense organs called the eyes. The structure of eye contains various modified structure which include the membranes and the attached muscles.

When light enters the light through the dome-shaped structure called cornea which contains the convex lens converges the light and light enters the hole called pupil through which light enters and strikes or get focused on the retina present at the back of the eye.

The pupil is attached to the ciliary muscles which dilate and contracts in the response of the intensity of light as during high light intensity, the pupil constricts whereas during the low light intensity the pupil dilates to allow the maximum amount of light.

Thus, pupil and retina is the correct answer.

3 0
3 years ago
What defines a symbiotic relationship?
rjkz [21]

Answer:

Symbiosis is a close relationship between two species in which at least one species benefits. For the other species, the relationship may be positive, negative, or neutral. There are three basic types of symbiosis: mutualism, commensalism, and parasitism! Hope this helps! you can simplify this answer!

Explanation:

8 0
3 years ago
Sheree observed an amoeba feeding by engulfing the prey with its false feet or pseudopods. this process is known as
dlinn [17]
<span>Sheree observed an amoeba feeding by engulfing the prey with its false feet or pseudopods. This process is known as phagocytosis.
The term comes from Greek and means: <em>phagein = to devour, kytos = cell, -osis = process, </em>so it literally means that it refers to a process in which a certain type of a cell (in this case, an amoeba) devours or eats another thing.
</span>
3 0
4 years ago
Other questions:
  • After a pet is diagnosed as being sick, Dr. Chun, the veterinarian, takes the temperature of every other pet in the center. He i
    8·2 answers
  • Which of the following statements are true of muscle diseases? Select all that apply.
    12·2 answers
  • Look at the jellyfish in figure 25-6. How many planes of symmetry could you draw through this animal?
    15·1 answer
  • Does the kingdom fungi consist both unicellular and multicellular organisms
    15·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Which statement best expresses the relationship between the three structures represented below?(1) DNA is produced from protein
    15·1 answer
  • DNA is a type of _______ that contains the genetic instructions of an organism's development and functioning.
    5·2 answers
  • What can biodiversity contribute to an ecosystem?
    14·1 answer
  • HELP PLEASE! WILL GIVE BRAINLY! Describe a strong, bond in which electrons are unevenly shared between two atoms due to a differ
    6·1 answer
  • Why would these modifications be important i.e.<br>what unique feature does Arthrobotrys have?)​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!