1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tatiana [17]
3 years ago
10

Based on the information in these age structure diagrams, which of the following countries have relatively equal birth and death

rates?
Biology
2 answers:
USPshnik [31]3 years ago
5 0

Answer:

Italy

Explanation:

baherus [9]3 years ago
4 0
The answer is C: Italy
You might be interested in
Tina, an environmental scientist, is protesting the use of polychlorinated biphenyl (PCB).
Lyrx [107]
<span>The EPA under the Toxic Substances Control Act also referred to as the TSCA are responsible for setting rules and regulations regarding polychlorinated biphenyl, PCB. Tina should reference the TSCA to help support her protest against the very toxic chemicals and compounds in PCB.</span>
6 0
3 years ago
A researcher recorded that a chemical reaction required 2.90 gal water and raised the temperature of the reaction vessel by 57 F
Bess [88]

<em>A. 11.0 L is the researcher's volume measurement to the SL units of liter</em>

<u>Explanation:</u>

Given that a researcher recorded that the chemical reaction has water = 2.90 gallon.

We have to convert the researcher's volume into the SL units of liter.

<em>So, we know that 1 gallon = 3.875 liters</em>.

Then we have to convert 2.90 gallons of water in to liters.

Then  , volume in L =(volume\ in \ gal) \times  (3.875 L/1 gal)                                   = (2.90) \times (3.875L/1 gal)                                  

= 11.0L

<em>Then the required volume in L= 11.0L</em>

7 0
3 years ago
1. Compare and contrast a food chain and a food web.
tigry1 [53]
In comparison they both show feeding relationship in an ecosystem.
In contrast, a food chain is a simple linear feeding relationship while a food web is a complex feeding relationship.

2) The arrows is to show the direction of the feeding relationship
8 0
3 years ago
Can someone please help me I'll give you brainliest I promise boo❤️
alekssr [168]

Answer:

The correct answer is Thermosphere.

Explanation:

I had the same question before and this was the correct answer.

5 0
3 years ago
Which of the following is a biotic factor that limits the carrying capacity of animal species?
Lelu [443]
I think the answer is B
8 0
3 years ago
Other questions:
  • a scientist investigates two types of cells located in different parts in the human body. cell A contains many more mitichondria
    8·2 answers
  • Driving automobiles and burning coal for electricity are examples of two human activities that negatively impact _______.
    5·1 answer
  • Compared to the weight of a person at the North Pole, the weight of the same person at the Equator would be
    14·1 answer
  • Lichens and mosses, followed by grasses and shrubs, slowly take root on a newly formed volcanic island. Eventually the grasses a
    12·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • All seed plants reproduce using
    9·1 answer
  • Yall please help quickly!! This would mean alot (: I hope you have a good day and a great year!!
    6·1 answer
  • HELP IM IN ZOON RN AND ILL GIVE YOU 56 POJNTS
    6·1 answer
  • Which of the following is a function of intercellular connections?
    8·1 answer
  • How would the role of gene expression in cells be best described?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!