1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ne4ueva [31]
3 years ago
5

What is photosynthesis?

Biology
2 answers:
dem82 [27]3 years ago
7 0
Photosynthesis is the process when the plant takes in carbon monoxide and turn it into oxygen and also makes sugar I think but it uses sunlight too.
Setler [38]3 years ago
7 0
Photosynthesis is the process of plants making food by using carbon dioxide, water with sunlight and chlorophyll to make glucose and oxygen
You might be interested in
Which of these statements is true about autotrophs, but not heterotrophs?
natka813 [3]
The third one,
Autotrophs use a process called photosynthesis to make their food. In photosynthesis, autotrophs use energy from the sun to convert water from the soil and carbon dioxide from the air into a nutrient called glucose. Glucose is a type of sugar. The glucose gives plants energy. Plants also use glucose to make cellulose, a substance they use to grow and build cell walls.
7 0
3 years ago
Read 2 more answers
Which occurs first?<br> seed<br> growth<br> mitosis<br> fertilization
NISA [10]

First comes fertilization, when two gametes combine to form a zygote.

3 0
2 years ago
Which statement BEST describes the organization of the periodic table of the elements?
Mashcka [7]
B is the answer for your question
5 0
3 years ago
What instrument is used to measure the average kinetic energy in a substance? calorimeter thermometer spectroscope voltmeter?​
s344n2d4d5 [400]

Answer:

The instrument used to measure the average kinetic energy of particles in a substance is thermometer. A measure of the average kinetic energy of particles in a substance is temperature

Explanation:

8 0
3 years ago
Experiment 1: A student tested to see if sunflower growth was affected by the hardness of the soil. She used control and experim
Marat540 [252]
Experiment one, because she repeated the experiment several times.
7 0
3 years ago
Read 2 more answers
Other questions:
  • State and describe the kind of relationship that exists between seagull and turtle
    11·1 answer
  • 3. The change in temperature during summer is due to<br> *
    8·1 answer
  • Which of the following is NOT part of the nitrogen cycle?
    9·1 answer
  • Which of the following is NOT a characteristic of all living things?*
    7·1 answer
  • I NEED HELP WITH THIS ASAP!!
    9·1 answer
  • Ciliates have a ______, which is a tougher membrane that allows them to change shape.
    14·1 answer
  • Which of the following structures consists mainly of white matter?
    13·1 answer
  • Transformation is the process by which a bacterium
    15·2 answers
  • Using the information in this photo, what can MOST LIKELY be learned about the rocks in the illustration?
    14·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!