1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lyudmila [28]
3 years ago
14

One of the amazing aspects of development is the proper placement and alignment of body parts. one of the best examples is the e

ye. light is first focused by the cornea onto the lens, which bends light to a sharp focus on the properly positioned sensory cells in the back of the eye. the developmental process that leads to increasingly greater specialization of cells as organs begin to take shape is termed __________.
Biology
1 answer:
lara31 [8.8K]3 years ago
3 0
Answer:  "induction" .
_________________________________________________________
You might be interested in
Which group of organisms is most likely relate to archeabacteria
olasank [31]
Protista organisms are most closely related to Archaebacteria.
7 0
3 years ago
What mineral is released within muscle cells to trigger contraction?
astraxan [27]

Answer:Troponin

Explanation:

3 0
3 years ago
Describe both innate and acquired immune systems and the importance of vaccines.
lbvjy [14]

Answer:

Innate immunity is a non-specific immune system which provides defence against any pathogenic microorganism in early stages. It includes physical barrier such as skin, chemical barriers such as saliva, tears, et cetera, phagocytic cells such as macrophages, et cetera.

Acquired immune system is the one which develops after exposure to pathogen or antigen. It is highly specific in nature. It includes B-lymphocytes and T-lymphocytes. It includes the production of antibodies.

Vaccines are used to develop acquired immunity in people. The process is termed as vaccination or immunisation. Heat-killed or weakened pathogen or antigen is inserted into a person after which a person develops antibodies and memory cells against that pathogen or disease. So, the immune system acts more vigorously against that pathogen in secondary infection.

Thus, a person becomes immunised.

3 0
3 years ago
What is the main function of the nucleolus? it produces enzymes that are then exported to the lysosomes. it produces cell adhesi
Kisachek [45]
The role of the nucleolus is to make the monomer of of ribosomes, and ribosomes are used in mRNA to make protein. Therefore the nucleolus plays a major role in the process of making proteins for our body. <span />
3 0
3 years ago
What are three reasons why nebulae contribute more to stellar formation than other regions of the universe? They are rich in hyd
Alisiya [41]

They are rich in hydrogen and helium, they have unlimited supply of hydrogen, they have a strong gravitational pull.

Explanation:

Space where huge size of gaseous and dust cloud is present is called nebula. It is mainly made of hydrogen and helium. Nebula exist in the space which is between the stars and it is call as interstellar space.

Helix nebula is closest nebula which is near the earth. It’s distance from earth is about 700 light years.

Dark nebulae are very dense as well as cold. Nebula can be divided into dark nebula and bright nebula. The gas which is present between the stars is always combine with solid grains cosmic dust.

4 0
3 years ago
Other questions:
  • In a hydrogen ion pump, the energy is used to join small molecules together to make larger ones. Which factor most likely has th
    7·2 answers
  • What forms when ATP releases energy? 1. AVP 2. AMP 3. ADP 4. ACP
    8·1 answer
  • Describe the cloning process of Dolly the sheep.
    8·2 answers
  • Which polypeptide chain will be made during translation of the following DNA sequence? -G-C-T-T-A-G-T-C-C-A-T-A
    10·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • how many people most likely represents a snapshot in time of a human society that existed 12,000 years ago?
    5·1 answer
  • Cells only synthesize DNA from the 5′ to the 3′ end, and since double-stranded DNA is complementary, both strands cannot be repl
    6·1 answer
  • Does wind and weather diverge at the equator?
    13·1 answer
  • Why is predation not a symbiotic relationship?
    13·1 answer
  • In a simple synapse, neurotransmitter chemicals are released by:.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!