1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
3 years ago
10

This is the total number of genes of every individual in an interbreeding population

Biology
2 answers:
Andrei [34K]3 years ago
8 0
Gene pools are the total number of genes of every individual in an interbreeding population.
Sonbull [250]3 years ago
7 0
Is there any options?
You might be interested in
Article name:What is melanin and how does it affect our eye,skin and hair color? is in Newsela<br>​
notka56 [123]

Answer:

melanin affects how one looks (1st question)

cause and effect (2nd question)

Explanation:

for the 2nd question, its cause and effect because uv rays hit our skin and our skin is affected which gives us suntan.

3 0
2 years ago
Read 2 more answers
Which is the correct pair of complementary nitrogenous bases in DNA?
serious [3.7K]
Adenine and thymine pair up. Just remember ATCG in that order, showing that adenine and thymine pair up, and so do cytosine and guanine
8 0
3 years ago
Read 2 more answers
What do both the theory of evolution and the cell theory have in common as scientific theories?
malfutka [58]
A) both have strong scientific support.
7 0
4 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
What evidence would you look for to see if a chemical reaction has occurred?
barxatty [35]
A change in the substance by temp, color, 
4 0
3 years ago
Other questions:
  • How do levels of acid rain and so2 emissions relate to each other
    5·1 answer
  • Which of the following observations helped Darwin shape his concept of descent with modification?
    9·1 answer
  • Are the nerves easy or difficult to find in the dissection of the starfish
    7·1 answer
  • A hypothesis that is scientific must have a test for proving it is called
    13·1 answer
  • Griffith's experiments with s. pneumoniae were significant because they showed that traits could be transferred from one organis
    8·1 answer
  • The American Sequoia is found only in
    11·2 answers
  • Every mollusk has a head, body, and _____. jointed legs a muscular foot hinged shells an external shell
    11·1 answer
  • I NEED HELP WITH MY FINALS!!!!
    14·1 answer
  • Why does a egg change color and texture when heated
    15·1 answer
  • A neap tide is when the tides have a big difference between high and low tide. *
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!