1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artemon [7]
3 years ago
12

Please help!!! Will mark brainliest!!!

Biology
1 answer:
Verizon [17]3 years ago
3 0

the correct answer is b

You might be interested in
Most dissolved carbon in the ocean is used to form which structure in marine organisms?
Ber [7]
<span>counteracted acidification</span>
6 0
3 years ago
Read 2 more answers
Did it rain today in texas?​
svetoff [14.1K]

Answer:

No, it did not rain today in Texas.

5 0
3 years ago
Read 2 more answers
Blood type is inherited thriugh mutiple alleles , inculding I ^a , I^b and i . A child has type A blood. If the father has type
lukranit [14]

Answer:

The answer is below

Explanation:

The possible phenotypes of the mother can be any of the following

AA - A phenotype

AB - AB phenotype (here the mother must have contributed an A gene for it to be possible)

AO - A phenotype (here the mother may have contributed any of the A or O gene.)

BO - B phenotype (here, the mother would only need to contribute O gene for this to be possible)

3 0
2 years ago
Hello, what is your favorite type of music
malfutka [58]

Answer:

EDM

Explanation:

I like the beats.

3 0
3 years ago
Read 2 more answers
Picking up a hot coal. Is na example of what type of heat. Transfer
murzikaleks [220]
Conduction, it is direct contact from the hand to the hot coal.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Why do you think millions of sperm are needed to fertilize one egg?
    8·1 answer
  • if carbon dioxide levels in the atmosphere double, which biome would be introduced in the Northwest territories
    10·1 answer
  • Describe the phases of the cell cycle. be sure to include the name of each phase and what is occurring within the cell during ea
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • PLEASE HELP!
    13·1 answer
  • Which body plan do you think is better, an endoskeleton or an exoskeleton? Defend your answer.
    8·1 answer
  • HeLp MeH...Which of the following is not true of endothermic reactions?
    11·1 answer
  • What year did matthias schleiden contribute to the cell theory?
    12·1 answer
  • Is the chromosome number related to the complexity of the<br> organism?
    7·1 answer
  • Traits are passed from parents to offspring. These traits are determined by
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!