1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
storchak [24]
3 years ago
6

It is logical to infer that two organisms which depend upon one another for survival must have been created together. true of fa

lse (I oNlY gEt 1 sHoT aT tHiS)
Biology
1 answer:
Salsk061 [2.6K]3 years ago
5 0

The answer is True

had the same question

You might be interested in
When blood glucose levels are difficult to control in type 2 diabetes some form of insulin may be added to the treatment regimen
ohaa [14]

The answer is number 3 use this to help you : https://quizlet.com/118565169/nsg-6005-week-8-flash-cards/

8 0
3 years ago
Name the main energy-<br> storing products of each<br> phase of photosynthesis.
olga nikolaevna [1]

Answer:

Rubisco

Explanation:

8 0
3 years ago
Question 4
tatuchka [14]

Protein breakdown into amino acids is the statement that correctly explains the complex molecule.

Option (c);

<u>EXPLANATION:</u>  

Cells in our body carry put several chemical reactions which in turn keep us healthy. All these reactions are collectively called metabolism. With the breakdown of complex molecules, it releases a lot of energy into the body.Through this process, Proteins are broken down into amino acids.

Various enzymes, specifically pepsin and hydrochloric acid breaks proteins into individual amino acids. They on further broken into a-keto acids. These amino acids reduces body weight and improves energy in the human body.

5 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Α-adrenergic receptors have a higher affinity for norepinephrine than for epinephrine. Β-adrenergic receptors have a higher affi
Molodets [167]

Answer:

Receptors are highly specific and only have high affinity for those ligands for whom they are specific.

Explanation:

Receptors are proteins that receive a stimulus or bind a ligand and mediate effects via receptor effector system.

Receptors are macromolecules that are highly specific.

The affinity between the ligand and the receptors is determind by the disassociation constant Kd.

The receptors produce maximun effect when an appropriate specific stimulus is present.

Different recptors types are present for different ligands.

For example, muscrinic receptors are specific for acetycholine and adrenergic receptors are specific for adrenaline/nor adrenaline.

It is important to know the specificity so that the body remains in a state of balance.

6 0
3 years ago
Other questions:
  • Which part of the brain is associated with ten of the 12 cranial nerves
    14·1 answer
  • What is true about a meal of a piece of salmon with garlic butter? high in fiber, low in protein. No vitamin B12, no iron, low i
    14·2 answers
  • If rain from a thunderstorm falls into a mountainous area, in what order will the rainwater flow through the surrounding geograp
    8·2 answers
  • The situation in which allele frequencies in the gene pool of A population remain constant is called
    6·2 answers
  • Can 2 species coexist in the same niche? Why or why not?
    7·1 answer
  • The most common map projections are based on three geometric shapes. Which of the following geometric shape is not one of the th
    15·1 answer
  • 1. Infer What is the energy source for the<br> water cycle?
    5·1 answer
  • Which is not a characteristic common to all minerals
    12·2 answers
  • Control and Data
    15·2 answers
  • Beneficial bacteria are found in our digestive tract
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!