1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crank
3 years ago
13

Why do you think DNA is duplicated before

Biology
1 answer:
Anna71 [15]3 years ago
5 0

The two cells that result from a single cell need to have the same amount of genetic material as the initial cell, therefore the DNA needs to be duplicated before the cell divides.

The sister chromatids are attached together so that during anaphase the daugther cells will receive the same chromosomes

You might be interested in
his nutrient is cycled between living things and the soil. Plants absorb this nutrient from the soil and turn it into organic co
djverab [1.8K]

The nutrient is phosphorus

<h3>The phosphorus cycle</h3>

Phosphorus cycles between living components of the earth (biosphere) and the soil (geosphere).

The element's reservoir is mainly the sediments of the ocean and rocks. Phosphorus gets into the soil by weathering of rocks.

Plants are able to pick the element up from the soil and animals are able to get their phosphorus by consuming plants.

When plants and animal die, their body decomposes and the phosphorus in them enters the soil.

Thus, the cycle being referred to in the illustration is the phosphorus cycle.

More on phosphorus cycle can be found here: brainly.com/question/15020567

#SPJ1

3 0
2 years ago
What distinguishes disruptive and directional selection pressures when both select for extreme genetic traits?
Stella [2.4K]

Answer:

Yes both are different. In directional selection one of the extreme traits is favored, whereas in disruptive selection both the extreme traits are favored.

Explanation:

Directional: If selection acts to eliminate one extreme form and supports the other extreme then the peak shifts in the direction which is selected by the nature.

Disruptive: If the selection does not favor the mean character value, rather favors both the peripheral character values then this kind of selection is called disruptive selection.

5 0
3 years ago
Read 2 more answers
Select the correct answer.
valina [46]

Answer:

I think it is preparation of medical reports

Explanation:

Hope it helps

4 0
4 years ago
What tissue makes up a bone?
Mashutka [201]

Answer:

Bone tissue is a mineralized tissue of two types, cortical bone and callousness bone

Explanation:

Other types of tissue found in bones include bone marrow, endometrium, peritoneum, nerves, blood vessels and cartilage.

6 0
4 years ago
Read 2 more answers
What is the a prey and predator animal?
alexira [117]
A prey animal could be a mouse and he predator could be a lion or cat
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which best describes a difference between prokaryotic cells and eukaryotic cells?
    7·2 answers
  • The cartilage in the throat that guards the entrance to the trachea and prevents fluid and food from entering it when a person s
    11·1 answer
  • Respondents of the national college health assessment who were sexually active indicated that _______ were the most commonly use
    12·1 answer
  • Which of the following is an important property of water?
    5·2 answers
  • Which part of the kidney acts as a funnel to pass the urine that is produced in several nephrons to the ureters?
    14·2 answers
  • What is the brain molecule named​
    13·1 answer
  • I am found in the mouth of the river when sediment is dropped by the river . What am I?
    7·1 answer
  • In what stage does a cell stay the longest in mitosis
    6·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • The principle hormones produced by the thyroid gland are:.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!