1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irakobra [83]
3 years ago
13

What is the next step in the lawmaking process after a bill is drafted?

Law
2 answers:
Goryan [66]3 years ago
6 0

Answer: the bill is sent to the house

Explanation: just is

Leya [2.2K]3 years ago
4 0

Answer:

it gets sent to a committee where the bill is thoroughly reviewed

Explanation:

When a bill is drafted and sponsored by a member of the congress, it gets sent to a committee where the bill is thoroughly reviewed and analyzed to know if it stands the chances of being accepted.  If the committee fails to deliberate on a bill sent to them, the bill would die off in the process and will not complete the process of becoming a law.

You might be interested in
During the Civil War, it was legal in some states to own enslaved people, but not in others. It was argued when an enslaved pers
pychu [463]

Answer:

A.The 13th Amendment

Explanation:

13th Amendment-This was created during the reconstruction of the south after civil war. The Amendment ABOLISHED SLAVERY.

15 Amendment-created to give Blacks right to vote which was part of the reconstruction amendments but only deal with freedom of Blacks to vote.

18th Amendment-This one Abolished Alchol.

20th amendment- Moved the beginning and ending terms of president and vice President.

I hope this helped.

5 0
3 years ago
Read 2 more answers
Legal decisions made by judges in court cases are called
Art [367]
"case law", or precedent.
7 0
3 years ago
A motion to dismiss made by the defendant is granted when: _________
Varvara68 [4.7K]

Answer:

b it is when t le plaintiff does not have a case

6 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Which speaker of which statement would be best served by joining an interest group? Help ASAP
gayaneshka [121]

Answer:

D. "I strongly support Republican candidates for public office"

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • 1 and 2 1 and 2 1 and 2 1 and 2
    13·1 answer
  • Your country has just experienced a difficult Civil War in which many resources was were destroyed and many citizens in lost the
    11·2 answers
  • Asking yourself whether your mind is currently occupied by things that can take your concentration off the road is something you
    13·1 answer
  • 3. Meena and Ala are two friends. Meena has a habit of using new pens almostevery day, whereas Ala believes in getting a refill
    15·1 answer
  • What is the appropriate age of criminal responsibility?
    14·1 answer
  • Instituciones de despenalización y suspension de la ejecucion de la pena
    9·1 answer
  • Making restitution is an allowable sentence under mn statue. Mn statue states the court may order the to make restit
    8·1 answer
  • My uncle chocked, and my aunt asked her child who was in the room and he and his child denied it. I am so upset because they don
    6·1 answer
  • How 4 phases effect the key economic business cycle​
    11·1 answer
  • Is this statement true or false? the 14th amendment weakened the power of the states. It gave the federal government the power t
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!