1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
4 years ago
7

Where is the water stored during the water cycle?

Biology
2 answers:
Marysya12 [62]4 years ago
6 0

Answer:

d. all of the above

Elis [28]4 years ago
6 0

Answer: d. All of the above

Explanation:

The water goes into the atmosphere during evaporation.

It's stored in the ground as runoff.

And stored in the ocean when it rains.

You might be interested in
The nervous system reacts to stimuli __________ compared to the endocrine system, adapts __________ compared to the endocrine sy
Fiesta28 [93]

Answer:

B. quickly; slowly; specific

6 0
3 years ago
Is there an equation for this?? or is it really simple that I just havent seen it ​
Zolol [24]
129/64.5 = 2
2 is the rate of change / unit rate.
129 times 2 = 258
6 0
3 years ago
A cell of an organism has four chromosomes. It undergoes a process at the end of which two daughter cells are produced. Each dau
Tanzania [10]
Mitosis, as a cell gives two daughter cells with the number of chromosome in daughter cells remaining same as that of parent, hence also known as equational cell division.
3 0
4 years ago
Read 2 more answers
“Just” a Theory?
Colt1911 [192]
In everyday life, a "theory" means a hunch, or a figure. In science a theory is the demonstrated consequence of a few trials. i.e. nuclear theory... we realize that molecules exist and that everything is made of iotas, yet in science the expression "law" is not utilized as a part of the case that ensuing confirmation ever surfaced to make a superior or more exact theory.
4 0
3 years ago
Sara measured the amount of potassium nitrate (KNO3) that could be dissolved in 100 grams of water at different temperatures. Sh
Goryan [66]

The amount of KNO3 that can dissolve in water increases as temperature increases.

8 0
3 years ago
Read 2 more answers
Other questions:
  • According to
    13·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • Compare and contrast the function of organelles
    11·1 answer
  • Here's another dinosaur skull--the allosaurus. Does
    13·1 answer
  • Risks in life are often misaligned with our perceptions of these risks. Describe why we fear flying in a plane, nuclear power pl
    12·1 answer
  • As part of their research on cell reproduction, Ms. Kelly's biology class designed various experiments to determine the best con
    11·2 answers
  • Humans ferment _______ in muscles where oxygen becomes depleted
    11·2 answers
  • while the lophophorate are a all recognized group phylogenic studies do not yet agree on the identity of their closest relatives
    6·1 answer
  • What is a result of both Normal and Reverse Faults?
    5·1 answer
  • Match the organisms in column A with their actions in column B
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!