The size of the proboscis helps the moth to consume the food (nectar) easily from Darwin's orchid.
<h3>What do you mean by Adaptation?</h3>
Adaptation may be defined as the process of modifying one's characteristics to better suit a situation and survive more efficiently.
The size of the tube that produces nectar is just 27.9cm long, while the length of the proboscis of a moth is 30.5cm. It easily consumes the nectar and gets energy for survival as well as reproduction.
Therefore, the size of the proboscis helps the moth to consume the food (nectar) easily from Darwin's orchid.
To learn more about Adaptation, refer to the link:
brainly.com/question/1213023
#SPJ1
To convert 100 inches per minute to feet per minute, we need a conversion factor to convert inches to feet. It is known that 1 foot is equal to 12 inches. We use this information.
100 inches / minute ( 1 foot / 12 inches) = 8.33 feet / minute
Explanation:
The polysaccharides have been broken down.
C. cellular respiration releases energy more slowly than fermentation does
Answer:
ACAAACUAGAUGGUACCAGAUAAUAUAUAGGCC
Explanation:
Splicing is the process of modification of primary transcript and occurs after the process of transcription. During splicing, intervening non-coding nucleotide sequences called introns are removed. The exons are joined together to make a mature mRNA whose nucleotide sequence would code for protein. The introns (in lower case letters) will be removed from the given sequence of primary transcript during splicing.
Primary transcript: ACAAACUAGAUGGUACgugacagatacagaguagugaaguagCAGAUAAUAUAUAGGCC
After splicing: ACAAACUAGAUGGUACCAGAUAAUAUAUAGGCC