1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bad White [126]
2 years ago
13

What property of dna makes it possible for a probe to find a single-stranded dna target gene?

Biology
2 answers:
djverab [1.8K]2 years ago
8 0
The human skin cells
Nookie1986 [14]2 years ago
8 0
THe answer would be skin cells!
You might be interested in
In Madagascar scientists have discovered a moth, xanthopan morganil praedicta, that has a 30.5 cm proboscis and feeds from and p
s344n2d4d5 [400]

The size of the proboscis helps the moth to consume the food (nectar) easily from Darwin's orchid.

<h3>What do you mean by Adaptation?</h3>

Adaptation may be defined as the process of modifying one's characteristics to better suit a situation and survive more efficiently.

The size of the tube that produces nectar is just 27.9cm long, while the length of the proboscis of a moth is 30.5cm. It easily consumes the nectar and gets energy for survival as well as reproduction.

Therefore, the size of the proboscis helps the moth to consume the food (nectar) easily from Darwin's orchid.

To learn more about Adaptation, refer to the link:

brainly.com/question/1213023

#SPJ1

3 0
2 years ago
Give an expression that converts 100 inches per minute to feet per minute.
LiRa [457]
To convert 100 inches per minute to feet per minute, we need a conversion factor to convert inches to feet. It is known that 1 foot is equal to 12 inches. We use this information.

100 inches / minute ( 1 foot / 12 inches) = 8.33 feet / minute
4 0
3 years ago
Read 2 more answers
Which best describes food when it reaches the stomach?
katrin2010 [14]

Explanation:

The polysaccharides have been broken down.

4 0
3 years ago
Which statement bet describes why even well-conditioned athletes have to pace themselves before athletic events that last severa
skad [1K]
C. cellular respiration releases energy more slowly than fermentation does
6 0
3 years ago
Consider the following RNA, transcribed from the complementary DNA. The RNA contains introns and exons. The exons are in upperca
Hunter-Best [27]

Answer:

ACAAACUAGAUGGUACCAGAUAAUAUAUAGGCC

Explanation:

Splicing is the process of modification of primary transcript and occurs after the process of transcription. During splicing, intervening non-coding nucleotide sequences called introns are removed. The exons are joined together to make a mature mRNA whose nucleotide sequence would code for protein. The introns (in lower case letters) will be removed from the given sequence of primary transcript during splicing.

Primary transcript: ACAAACUAGAUGGUACgugacagatacagaguagugaaguagCAGAUAAUAUAUAGGCC  

After splicing: ACAAACUAGAUGGUACCAGAUAAUAUAUAGGCC

7 0
3 years ago
Other questions:
  • Does the distribution of bases in sea urchin dna and salmon dna follow chargaff's rules?
    11·1 answer
  • If you wanted to make a copy of dna in the lab, which protein would you need to complete the synthesis of a new strand of dna?
    12·1 answer
  • Can i get help on this please
    11·1 answer
  • What is an Otorhinolaryngologist
    14·1 answer
  • Which of the following will be expected to be activated during times of prolonged starvation? (select all correct answers)
    6·1 answer
  • Which type of light can humans perceive with the eye?
    8·2 answers
  • I need to know 3 examples of producers in a desert habitat because i need to create a poster with an ecosystem of a deert
    13·1 answer
  • What is 1+1<br><br> this is rlly hard bro someone plz help
    5·2 answers
  • To reproduce, female elephants produce eggs and male elephants produce sperm. Offspring are produced by the fusion of an egg wit
    6·2 answers
  • What is the difference between the sympathetic and parasympathetic division of the nervous system?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!