1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
steposvetlana [31]
3 years ago
6

What is the initial velocity of the boiling water? H=-16t^2+170t

Mathematics
1 answer:
erastova [34]3 years ago
5 0
Idkfjdjiwkwhdjajajasjjaikajshsiskjdhdjdjsjjsjsjsjsjss
You might be interested in
How to calculate the area of a square
lilavasa [31]

Answer:

a × a × a ×a

Step-by-step explanation:

Area is measured in "square" units. The area of a figure is the number of squares required to cover it completely, like tiles on a floor.

Area of a square = side times side. Since each side of a square is the same, it can simply be the length of one side squared.

square has one side of 4 inches, the area would be 4 inches times 4 inches, or 16 square inches.

7 0
3 years ago
ASAP PLS HELP!
rjkz [21]

Answer:

A scatter plot shows a negative trend if y tends to decrease as x increases. A scatter plot shows no trend if there is no obvious pattern.Step-by-step explanation:

3 0
3 years ago
If x has a mean of 17.2 g and a standard division of 14.0 g and y has a mean of 23.5 g and a standard division of 16.4 g and the
dimulka [17.4K]

The least squares regression line is y=0.6831x+11.25

Step-by-step explanation:

LSRL is the the Least Squares Regression Line.The formula for regression line is y=mx+b where m is the slope of the line and b is the y-intercept value of the line.

First find the slope, m of the line from the means and standard deviations given

x has a mean of 17.2 g and a standard deviation of 14.0 g

y has a mean of 23.5 g and a standard deviation of 16.4 g

The correlation coefficient in both cases is 0.83, hence the slope m is given by;

m=r(Sy/Sx) where m is the slope of the line, Sy is standard deviation of y values, Sx  is standard deviation of x values and r is the correction coefficient.

m= 0.5 * 23.5/17.2 =0.6831

Find the value of b, the y-intercept

b=Y-mX where X and Y are the mean values for x and y respectively

b=23.5-0.6831*17.2

b=23.5-11.75=11.25

The LSRL is y=0.6831x+11.25

Learn More

Least Squares regression Line : brainly.com/question/4090838

Keyword : standard deviation, least square regression line

#LearnwithBrainly

3 0
3 years ago
Ms. Wood spills a milkshake on a rectangular piece of paper as shown below. Which of the following best approximates the area of
MakcuM [25]

Answer:

b.300cm

Step-by-step explanation:

4 0
3 years ago
In the first quadrant you start at (7,3) and move 5 unit left
AveGali [126]

Answer:

That would be (2,3)

Step-by-step explanation:

When we're moving left in the coordinate plane, we are subtracting the x-coordinate by how much distance we move.

In this case, 7-5=2, so the new x-coordinate is 2, but the y-coordinate doesn't change since we're going horizontally and not vertically.

7 0
3 years ago
Other questions:
  • What is the measure A?
    5·1 answer
  • You spend half of your money on a movie ticket. Then you spend half of what you have left to buy a large popcorn. Then you spend
    10·1 answer
  • If a prime number cannot be
    8·1 answer
  • What is the slope between the points (9 -1) and (-2 5)
    5·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • 1.03 – 0.06 <br> subtracting Desimals of Different Lengths 1c
    10·1 answer
  • Diego's age `d` is 5 more than 2 times his sister's age `s`. This situation is represented by the equation `d=2s+5`. If we know
    9·1 answer
  • I need help with 5,6,7 please
    14·1 answer
  • Please help me<br><br> (6x + 5 - 3x + 16) divided by 3 x 15 divided by 5
    11·1 answer
  • 16,047
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!