1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lelu [443]
3 years ago
13

Which is a natural native result of eating too many lipids

Biology
2 answers:
pantera1 [17]3 years ago
7 0

Answer:

Eating excessively lipids expands chance for some dangers of well being.  

Explanation:

An eating routine which is wealthy in lipids can raise cholesterol levels which are found in the blood and this prompts expanded coronary illness chance.  There are trans fats which are found in stick margarine, bundled snacks, and broiled sustenances which makes cholesterol to be high. All together for a man to survive, he/she needs fat in the body however it ought to be taken in the control of supplements.  Eating excessively lipids somebody can be hefty or overweight and this draws out the danger of colorectal and prostate disease, bosom tumor, and endometrial.

Tatiana [17]3 years ago
6 0

Eating too much lipids increases risk for many threats of health.

A diet which is rich in lipids can raise cholesterol levels which are found in the blood and this leads to increased heart disease risk.

There are trans fats which are found in stick margarine, packaged snacks, and fried foods which makes cholesterol to be high. In order for a person to survive, he/she needs fat in the body but it should be taken in the moderation of nutrients.

Eating too much lipids someone can be obese or overweight and this brings out the risk of colorectal and prostate cancer, breast cancer, and endometrial.

You might be interested in
Corn is a type of grass.
borishaifa [10]
Corn, believe it or not, is indeed a type of grass. It has been selectively bred, and genetically engineered to produce large ears of corn.
8 0
3 years ago
Read 2 more answers
Which of the following is the best way to slow the greenhouse effect? drive more often stop using electricity use energy sources
LenaWriter [7]

Answer:

b. stop using electricity

Explanation:

6 0
3 years ago
Read 2 more answers
Sound is a mechanical wave. Therefore it ———
Elenna [48]

D must travel through a medium is your answer

Hope this helps

God bless you

Have a great night

-Kayla :)

5 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Assessing biodiversity:
Helen [10]

Answer:

The correct answer will be option-A

Explanation:

Biodiversity refers to the diversity of the biological entities present in an ecosystem. Biodiversity has a wide spectrum which not only includes the number of the diversity of the organism but also the interaction between them.

The biodiversity is assessed to study the changes that are taking place in an ecosystem, to study the causes and how the changes affect the human well being.

The assessment decisions ignore the personal interests and the biasness as the aim of the approach is not fulfil the personal needs but to maintain sustainable management of the ecosystem.

Thus, option-A is the correct answer.

8 0
3 years ago
Other questions:
  • How does photosynthesis help plants meet their basic needs?
    9·1 answer
  • Another name for hidden testes?
    11·1 answer
  • Which color of light is absorbed the most by chlorophyll a? what percentage is absorbed? what percentage is reflected??
    5·1 answer
  • Jumping Jack Flash is a champion racehorse. A special diet and daily exercise have made him the fastest horse in the country. In
    11·2 answers
  • This refers to an increase in some quantity over time. in organisms, this is a result of mitosis.
    9·2 answers
  • Plz help me just numbers 11 and 13 <br><br><br><br>Thx you
    9·1 answer
  • Which term describes an injury that does not break the skin and is characterized by swelling, discoloration, and pain?
    5·1 answer
  • Changing the state of matter from gas to liquid requires a gain in thermal energy. True or false
    5·1 answer
  • Which term best describes the event caused by the positions of Earth, the Moon, and the Sun shown in the diagram?
    12·1 answer
  • What type of structure are different internally but have evolved to perform the same function?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!