1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marina86 [1]
3 years ago
14

Sonya is playing a board game, and each space on the board game measures 1 centimeter. She moves her game token 5 spaces up from

the start position. Then she moves it 5 spaces to the left. Finally, Sonya moves her token 2 spaces down.
What is the total distance the token moved?


2 cm

8 cm

12 cm

15 cm
Biology
2 answers:
Diano4ka-milaya [45]3 years ago
4 0

The total distance the token moved is 12 cm.

Given : space on the board game measures 1 centimeter

5 cm (up) + 5 cm (left) + 2 cm (down) = 12 cm

Luda [366]3 years ago
3 0

Answer:

12cm

Explanation:

5+5+2= 12cm

You might be interested in
When a human egg is fertilized, the sex
Ulleksa [173]

Answer:

the child will either receive either an X or a Y chromosome from the father

Explanation:

The mother always give the child an X chromosome because thats the only one she can give

the father can either give an X or a Y which determines if the child will be female or male

4 0
2 years ago
A plant grows faster and fuller due to large amounts of fertilizer. If the plant cross-pollinates with another plant later, how
Softa [21]
C is the answer to this.
4 0
3 years ago
Read 2 more answers
Which are limiting nutrients for plant growth?
Strike441 [17]

Answer:

Nitrogen and phosphorus are among the elements considered most limiting to plant growth and productivity because they are often present in small quantities locally or are present in a form that cannot be used by the plant.

Explanation:

6 0
2 years ago
Which area of biology states that living things undergo gradual, structural, and functional changes over long periods of time
Tasya [4]

Given what we know,  we can confirm that the area of biology that states that living things undergo gradual, structural, and functional changes over long periods of time is referred to as evolution.

<h3>What we know about evolution. </h3>
  • This is a theory that was put forward by Charles Darwin.
  • Evolution accounts for the structural and functional changes that are passed down from one generation to the next.
  • The changes produced by evolution are very slow in that they may take many generations to complete a noticeably change.
  • These changes are hereditary.

Therefore, we can confirm that the theory of evolution put forward by Charles Darwin states that living things undergo gradual, structural, and functional changes over long periods of time.

To learn more about the theory of evolution visit:

brainly.com/question/2491140?referrer=searchResults

6 0
2 years ago
A single pair of goldfish in an aquarium produced a large number of offspring. These offspring showed variations in body shape a
vagabundo [1.1K]
The most likely explanation for the variation is the offspring were produced from different combination of genes. A single pair of gold fish mentioned in the question means a male and a female gold fish. The two of them mated and contributed different genes to the fertilized fish eggs, this results in production of various body shape and colouration which is known as variation.
4 0
3 years ago
Other questions:
  • Ok, I need someone to explain what is meant by If there were five guanine bases in DNA I am really confused.
    15·1 answer
  • How many hydrogen bonds exist between this dna strand and its complementary strand?
    9·2 answers
  • What role does the endomembrane play
    9·1 answer
  • Butterflies laying their eggs on milkweed plants occurs at what level of the biosphere hierarchy?
    13·2 answers
  • Watson and Crick discovered that DNA is __________. A. the genetic information B. very small C. a double helix D. a treatment fo
    9·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Incorporate government into the table by assuming that it plans to tax and spend $26 billion at each possible level of gdp. Also
    10·1 answer
  • True or False The light dependent reaction does not need sunlight to occur.
    15·1 answer
  • No Light<br> Yo =<br> Gas<br> Gas<br> Water<br> Plant
    9·1 answer
  • What is the weather like at a front boundary?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!