1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
muminat
3 years ago
6

What is the annual dose-equivalent limit for the skin and hands of an occupationally exposed individual?

Biology
1 answer:
zaharov [31]3 years ago
7 0

Answer:

Application        Dose limits

********************************************************************************************

Effective dose (whole body), Hp (10)    50 mSv per year (or 1mSv per week)

20 mSv per year (or 0.4 mSv per week) averaged over  

defined periods of five years

Annual equivalent dose to lens of the eye, Hp (3)  150 mSv

Annual equivalent dose to the skin, Hp (0.07)  500 mSv

Annual equivalent dose to hands and feet   500 mSv

Explanation:

You might be interested in
Define genus and species. how are they related to the binomial nomenclature of an organism?
IrinaVladis [17]

A genus is typically the name for a small group of closely related organisms. The second part of a scientific name, axyridis in this example, is the specific epithet. It is used to identify a particular species as separate from others belonging to the same genus.

3 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
You inoculate two tubes of liquid culture medium with 100 bacterial cells and incubate one tube at 37°C and the other at 55°C. A
Nady [450]

Answer:

thermophile.

Explanation:

A thermophile is a kind of bacteria that belongs to the Archaea Domain and they are the kind of animals that can live in a region of high or extreme temperature. There has been a research on a kind of thermophile which is known as Methanopyrus kandleri which can exist in an extreme temperature of up to 500° C.

So, if we take a look at the question again we can see that after 48 hours and at 37°C 20,000 bacteria per milliliter are already in the tube and at more higher temperature of 55°C we have 1,568,000 bacteria per milliliter which means that at higher temperature more of the bacterial is produced.

5 0
3 years ago
tropical rain forest tend to have soils that are nutrient poor, and most of the nutrient are found in the top few inches of the
Sliva [168]

Answer:

They either get their source of nutrients from something else. Or, they could also have shorter roots so that they only reach the top of the soil. They probably won't need as much nutrients to survive either.

Explanation:

5 0
3 years ago
Read 2 more answers
What is the harmful impact the use of insecticide has on the environment
zimovet [89]
Well the insects eat the plant and the small animals eat the insects and so on.if the insects die the food chain is broken. 
4 0
3 years ago
Other questions:
  • The nurse hears a pregnant client yell, "oh my! the baby is coming!" after placing the client in a supine position and trying to
    10·2 answers
  • Which process is represented
    14·1 answer
  • Which of the following is thought to be engulfed by prokaryotes eventually leading to the development of plant cells?
    12·1 answer
  • Which of the following items would be included as part of earth science?
    11·2 answers
  • Explain how the ozone hole was found and what the UN did to help it
    11·1 answer
  • What amino acid sequence would be made from the mRNA sequence CGCUAUAGC
    14·2 answers
  • What would happen to the light independent reactions if you put a plant in a dark closet for many days?
    9·1 answer
  • Water, carbon dioxide, oxygen, and some other substances can pass through the cell wall. _________________________ (true or fals
    5·1 answer
  • Describ how animals receive their energy indirectly from plants?
    5·1 answer
  • How is the rate of photosynthesis measured
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!