1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
d1i1m1o1n [39]
3 years ago
7

Consider the equation below. log_4( x + 3 )= log_2 (2 + x ) Which system of equations can represent the equation?

Mathematics
2 answers:
kenny6666 [7]3 years ago
9 0

Answer:

y1=log (x+3) / log 4, y2= log (2+x) / log 2

Step-by-step explanation:

DaniilM [7]3 years ago
4 0

Answer:

4^y = x + 3

2^y = x + 2

Step-by-step explanation:

log_4(x + 3 ) = log_2 (2 + x )

log_4( x + 3 ) = y

log_2 (2 + x ) = y

4^y = x + 3

2^y = x + 2

You might be interested in
456.05 which digit is in the tenths place
mel-nik [20]
It's the zero in the tenth place
   
3 0
3 years ago
3) Of the 20 cookies at the bake sale, 35% are gingerbread. How many
KIM [24]

Answer:

the answer is 8. 75.

Step-by-step explanation:

25×35% = 8.75

7 0
2 years ago
What is 64 mi/h =_____ft/s ?
victus00 [196]
31.288889,because hours have 60 min,1 min have 60 seconds so you will do 64/60=1.066666667/60=.0177777778
6 0
3 years ago
How to write four hundred two million seventy-three thousand one hundred eighty in standard form
ziro4ka [17]
Four hundred two million seventy-three thousand one hundred eighty in standard form: 402,073,180 would be your answer
5 0
3 years ago
Read 2 more answers
Wich expression represent the sum of 59 and x
KIM [24]
I don't see the answers, but it would most likely be 59 + x.
7 0
3 years ago
Other questions:
  • Does the point (-4, 3) fall on the graph of this line? How do you know? Show your work. ( 2 points) PLEASE HELP ILL MARK BRAINLI
    10·1 answer
  • When Derek planted a tree it was 36 inches tall. The tree grew 1 1/4 inches per year. The tree is now 44 3/4 inches tall. How ma
    12·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Dawit was earning $100 per week in January. He got a raise of 10% in March, but then a 10% reduction after changing jobs in Augu
    12·2 answers
  • Gita puts tires on 21 bicycles and tricycles. She uses 53 tires in all. How many tricycles are there?
    12·1 answer
  • Using the graph of f(x) and g(x), where g(x) = f(k•x), determine the value of k.
    9·1 answer
  • The point (4, 12) is an ordered pair in a proportional relationship. What equation represents this relationship?
    7·1 answer
  • Can someone plz help me on this plz I have the answer just making sure I’m right. Plz no link s
    8·2 answers
  • Divide $70 in these ratios 8:5:1
    11·1 answer
  • Zach substitutes the values 32 inches, 20 inches and 20 inches into the Pythagorean theorem. Explain what Zach is most likely tr
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!