Answer:
In the mountains
Explanation:
because its hotter near the equater and it doesnt get that much rain unlike up in the mountains
A plant grew from a leaf cutting will reproduce asexually.A plant cutting refers to a piece of plant that is used to vegetatively propagate a plant. A plant cutting can be a piece of stem, root or leave. The plant cutting is usually placed inside a suitable medium, where the cutting will grow to produce a new plant under suitable conditions. Plants that are grown from plant cutting are considered to be reproduce asexually, because vegetative propagation is a form of asexual reproduction.
Answer:
These dwellings are called gers, and during the Mongol Empire they consisted of a round, collapsible wooden frame covered in felt.
Explanation:
hope it helps
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
