1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
prisoha [69]
3 years ago
6

Please help 22 points and brainliest.

Biology
1 answer:
antiseptic1488 [7]3 years ago
4 0

Answer:

a

Explanation:

You might be interested in
All the members of a species that live in an area make up?​
sveticcg [70]

if they are all part of the same species it would be a population

5 0
3 years ago
Read 2 more answers
Which method of heat transfer can occur in empty space?.
nordsb [41]
Heat radiation.

This is the form of heat transfer that doesn’t need a medium to transfer through.

That’s how heat from the sun gets to earth, even though empty space is very cold.
3 0
3 years ago
Read 2 more answers
Temperature regulatory apparatus of the mammal include the following pairs
Kryger [21]
The correct answer is D
3 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
14. At certain times of the year, the male sage grouse can be seen inflating the air sacs on his chest and singing loudly to a f
beks73 [17]
A courtship dance or mating ritual hope this helped 
7 0
3 years ago
Other questions:
  • If George is startled by a loud noise immediately after his baby sister cries, he is likely to become fearful every time she cri
    9·2 answers
  • The scales of female pine cones produce a sticky substance. what function might this serve?
    15·1 answer
  • What will happen if your body doesnt have skin
    10·2 answers
  • Where do many of the cell's metabolic processes take place?
    9·1 answer
  • Blood vessels that contain valves and rely on skeletal muscles to move blood are called:
    5·2 answers
  • .a i What does a food chain mean to you?
    7·2 answers
  • Which of the following does NOT accurately describes a typical human karyotype?
    13·2 answers
  • an electric car uses a battery to make the car move. what kind of energy transition is happening in the car?
    10·1 answer
  • FRAMESHIFT mutation. Explain what this means and how it affects the<br> protein
    8·1 answer
  • DNA makes us all unique by controlling the production of _______that make us look different and have the structures to better su
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!