1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ratling [72]
4 years ago
6

What is genetically modified food

Biology
2 answers:
denis23 [38]4 years ago
3 0
Genetically Modified food, also known as GMO's, are chemicals that farmers and such put in cops or animals food in order to make them bigger, more tasteful, and have possible more shelve life. Hope this somewhat helped:)
SashulF [63]4 years ago
3 0

Answer:

Genetically modified foods as the name indicates are altered at the gene level. The plants are altered through hybridization, genetic engineering by changing the gene sequence such that the outcome is a desirable product such as increased shelf life of tomatoes, BT-Brinjal etc.,

You might be interested in
What are five similarities and five differences between bony fish and cartilaginous fish?
MA_775_DIABLO [31]

Differences

Bony Fish

They are both fresh water as well as marine.

Endoskeleton is made up of bone.

They have 4 pairs of gills.

Cloacal aperture is absent.

mouth is normally terminal

Cartilaginous Fish

They are marine.

Endoskeleton is made up of cartilage.

They have 5-7 pairs of gills.

Cloacal aperture is present.

mouth is at the ventural surface

similarties

Bony fish and cartilaginous fish represent two classes of aquatic chordates. Both bony fish and cartilaginous fish belong to the superclass Pisces. Both bony fish and cartilaginous fish have an endoskeleton.are their centralized nervous systems, their sizes are similar, they both belong to the phylum chordata, they are both a family of the fish, and both have a lateral line organ that enables the fish to detect movement and vibration in the water surrounding them.

Explanation:

7 0
3 years ago
Mike has suffered brain damage after only a light blow to the head. Mike could have ___________ cerebrospinal fluid in the _____
Bess [88]
I believe the correct answer from the choices listed above is the last option. <span>Mike has suffered brain damage after only a light blow to the head. Mike could have too much cerebrospinal fluid in the central nervous system. Hope this answers. Have a nice day.</span>
5 0
3 years ago
Read 2 more answers
PLS HELP. I WILL MARK BRAINLIEST!
Kobotan [32]

Answer:

3 because when filled in there will be a total of 3 a's

5 0
3 years ago
Read 2 more answers
It is important to understand that the wilcoxon matched-pairs test is based on the relative ranks of
egoroff_w [7]
Hi the answer is based on the ranks of the difference scores between the matched pairs.
3 0
3 years ago
What causes the seasons? Please use two complete sentences
Natali [406]
The earth moves closer to the sun and we get summer. then when the earth moves further from the sun, we get winter.
3 0
4 years ago
Read 2 more answers
Other questions:
  • Which of the following statements is true?
    10·2 answers
  • Explain Biology in detail? Will mark as brainy. Please
    10·2 answers
  • White vinegar is an alternative cleaning product that helps:
    6·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • How do cells regulate gene expression using alternative rna splicing?
    7·1 answer
  • The first land battle of the Civil War was fought at a Gettysburg b Bull Run c Antietam d Shiloh
    15·2 answers
  • When an organism fights with another organism over a limited resource it is called?
    11·2 answers
  • Please help me with this.
    14·2 answers
  • How does carbon cycle through Earth's systems?
    7·1 answer
  • 26.Transcribe this strand of DNA to mRNA, then translate that mRNA to.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!