1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mamaluj [8]
3 years ago
12

Horticulture has a large support system to agriculture.This is known as the ?

Biology
1 answer:
lara31 [8.8K]3 years ago
4 0
It was percentage i figrer it out
You might be interested in
Compare and contrast artificial selection with natural selection
kumpel [21]
Artificial and Natural selection are really the same process but one is driven by man and the other is driven by an organism's traits that allow them to survive and reproduce. Artificial selection is when mankind chooses certain traits in plants and animals and breeds to enhance that trait.
6 0
4 years ago
Which statement correctly explains the polarity of the water molecule?. A) The hydrogen end of the molecule has a partial negati
vaieri [72.5K]
B I think but I am not sure hope this helps
6 0
3 years ago
Read 2 more answers
Which of the following events is caused by magnetic force?
emmasim [6.3K]

Answer:

A magnetic storm is a period of rapid magnetic field variation. It can last from ... When these events occur, we can experience a truly large magnetic storm

Explanation:

6 0
3 years ago
Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For thi
Likurg_2 [28]

Answer:

DNA: ATGGGGGCGATATTTTATCCGACG

RNA: AUGGGGGCGAUAUUUUAUCCGACG

Protein: MGAIFYPT

Explanation:

Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.

7 0
3 years ago
Which of the following processes causes the release of nitrogen back in to the atmosphere?
LenaWriter [7]
The nitrogen cycle. Animal and plant waste decomposes and adds nitrogen to the soil, which bacteria convert into a form that plants use to grow. Animals eat the plants, which completes the cycle.
3 0
4 years ago
Other questions:
  • A volcanic eruption releasing rock, ash, and dust particles into the air is an example of which interaction?
    12·1 answer
  • Researchers crossed a heterozygous tall pea plant (Tt) with a homozygous short pea plant (tt). What is the probability that this
    7·1 answer
  • PLEASE HELP ME I DON'T UNDERSTAND WHAT ITS ASKING! I will give a brainlist for who answers and explains it.
    9·2 answers
  • What are 3 characteristics of a nucleotide
    5·1 answer
  • How are key features of exponential functions determined and interpreted from a graph and table
    10·1 answer
  • The process by which sperm is made is called
    14·2 answers
  • Explain why sex-linked traits almost always appear in men instead of women despite being found on the X chromosome.
    15·1 answer
  • How can changing conditions, such as the introduction of disease impact the numbers and types of organisms in an ecosystem? Prod
    13·1 answer
  • Meow :3 help me plsss
    7·1 answer
  • Runoff pollution from farms and other non-point source is in Chesapeake Bay watershed can cause what to happen in the bay? Hurry
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!