1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katen [24]
3 years ago
15

The instructions for making protein comes originally from

Biology
2 answers:
vfiekz [6]3 years ago
6 0

Answer:

The instructions for making protein comes originally from GENES.

Explanation:

Genes, present in nuclei of cells, contain information in DNA needed to produce proteins(functional molecules).

This process consists of two major steps: TRANSCRIPTION AND TRANSLATION. Together, transcription and translation are known as gene expression.

In transcription, the messenger RNA(mRNA), carries the information, or message, from the DNA out of the nucleus into the cytoplasm.

Translation occurs in the cytoplasm and here the mRNA interacts with a ribosome which "reads" the sequence of mRNA bases.

A type of RNA called transfer RNA (tRNA) then assembles the protein, one amino acid at a time.

mr Goodwill [35]3 years ago
4 0
DNA or <span>Deoxyribonucleic acid </span>provides the blueprint for making a protein
You might be interested in
Sand is an example of a mineral.<br><br>Help ASAP!!
docker41 [41]

Answer:

Sand is an example of a mineral.

3 0
3 years ago
Read 2 more answers
Which is not a function of the kidneys?
NikAS [45]

Answer:

D. They release waste into the bloodstream.

Explanation:

Kidneys are the primary organs of the excretory system. Their primary function is to remove the metabolic waste from the blood and release it out of the body in the form of urine. The nitrogenous waste, drugs, uric acid, and other metabolic waste products are removed from blood in kidneys.  

Hence, kidneys do not release the waste into the bloodstream, rather release them out of the body and filter the blood.  

8 0
4 years ago
How can you tell if a frog is sad?
Aneli [31]

Answer:

if it don't crock

Explanation:

3 0
3 years ago
Write a hypothesis to explain why the female leatherback digs two holes
liubo4ka [24]

Explanation:

Because it needs a place to hide and place it eggs.

7 0
2 years ago
Read 2 more answers
Which of the following substances must enter the cell through the cell membrane for the cell to live
Zinaida [17]

Answer: C

The substance that must come through the cell membrane for the cell to live is nutrients. Cells would die if they did not get nutrients. Nutrients are what keeps the cell running.

8 0
4 years ago
Other questions:
  • What experimental evidence was provided for the nuclear model of the atom?
    9·2 answers
  • Illustrated above is an urban heat island profile what is the source of the majority of the heat downtown
    12·1 answer
  • 5)
    7·1 answer
  • What is the circulatory system's function?  :)
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • How the reproduction is done in leishmania how is it different from amoeba​
    15·1 answer
  • Define "phospholipid bilayer"
    14·1 answer
  • Pls help im begging
    5·2 answers
  • Can I have help pls I do not understand this
    10·1 answer
  • True or false; There are several branches of oceanography.​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!