1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga_2 [115]
3 years ago
7

Fill in the blank. An (blank) solution occurs when the solute concentration outside of the cell is higher than

Biology
1 answer:
lozanna [386]3 years ago
5 0

Answer: It is Hypertonic solution.

Explanation:

Hypertonic solution is a solution in which the the solutes Concentration outside the cells is greater than solute concentration inside the cell. When a cell is in Hypertonic solution, water will move out of the cell and it will shrivel. The cell will shrinks or cremated and may eventually die.

You might be interested in
ATP is producer during the process of cellular respiration witch is the order of the steps of cellular respiration
bija089 [108]
Photosynthesis is the opposite of cellular respiration.

glucose is converted into ATP during cellular respiration.

Light energy + Oxygen = Glucose

We breathout CO2 during the process of cellular respiration.

PLEASE ASK IF YOU HAVE ANY QUESTIONS :)
6 0
3 years ago
Mutations can be<br> beneficial.<br> neutral.<br> harmful.<br> all of the above
d1i1m1o1n [39]
Harmful because they change how the genes are supposed to form and they can give disorders at times. 
4 0
3 years ago
The movement of tectonic plates in two locations is described below:
makkiz [27]
Volcanic eruptions may occur in both locations, as the movement can cause the tectonic plates to allow magma through.
7 0
3 years ago
Read 2 more answers
In the Galapagos islands, marine iguanas swim in salt water and vent excess salt from their nostrils. Iguanas who are more effic
marissa [1.9K]
Should be A. the again c. might work to?
3 0
3 years ago
Read 2 more answers
Which age of rocks are missing in NYS?
QveST [7]

Answer:

Adirondacks "Missing Time" Formation

8 0
3 years ago
Other questions:
  • In what organelle is the genetic material found inside
    13·1 answer
  • The nurse observes rebound tenderness in the abdomen of a patient. what condition does this finding indicate?
    9·1 answer
  • True or False: According to Klass, research published in the journal Pediatrics described differences in children's brain activa
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Please help I’ve been stuck on this for so long :(
    8·1 answer
  • Is this Heterozygous, hom0zygous dominant, hom0zygous recessive?
    11·2 answers
  • A hypothesis that girls have better memory than boys
    5·1 answer
  • What is soil salinization
    13·2 answers
  • This pedigree diagram shows how a dominant trait is
    9·1 answer
  • Classify each description as applying to organisms in one, several, or all of the domains of archaea, bacteria, and eukarya.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!