1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
7nadin3 [17]
3 years ago
13

What happened's if the body looses water and salt

Biology
1 answer:
schepotkina [342]3 years ago
7 0

Answer:

you won't survive a week without water

You might be interested in
Consider the scenarios described below. Match the concept described by the scenario with the theory.
astraxan [27]

Answer:

1 - natural selection

2 - uniformitarianism

3- inheritance of acquired characteristics

4 - catastrophism

Explanation:

1. Natural selection refers to the evolution of organism or changes in the characterstics of organism depending on the environmental conditions. Hence, the lizard moved on fantasy island evolved with larger head and stronger bites as per the environmental condition.

2. The concept of Uniformitarianism states that the natural geological processes happening in present have already occured in past with same intesity and rate. Hence, geologist uses the phrase "The present is the key to the past" for  formation of mountain, rock formation and water movements.

3. Inheritance of acquired characteristics are the characteristic acquird by the ancestors and transmitted that gradually acquired characteristic to their progeny. Hence, the rats acquire the charactieristics and transfered it to the next generations.

4. Catastrophism means the regular occurrence of meteorological and geological disturbances to explain the existence the fossil record. Hence, teh mass exticiton due to asteroid impact is an example of Catastrophism.

So, the correct options in sequential order is natural selection, uniformitarianism, inheritance of acquired characteristics, and catastrophism.

3 0
3 years ago
We know that if you place a houseplant on a windowsill, it will soon orient its leaves toward the light. Turning the plant will
Vsevolod [243]

Answer:

D. The substances utilized in response to light are produced in the terminal bud.

Explanation:

The substances which are produced in the apical meristem are known as the auxins.  are responsible for solar tracking in plants. are a powerful growth hormone that are produced naturally by plants. They are mainly found in shoot and root tips and promote cell division, stem and root growth. They also drastically affect plant orientation by allowing cell division to one side of the plant in response to sunlight and gravity. That response to sunlight by the hormone is know as phototropism where the plant would move towards the source of light which promote its growth. The movement of auxins due to gravity it is known as geotropism where the hormones moves to one side of the root in response to gravity.  

3 0
3 years ago
Read 2 more answers
Which of the following normally occurs during mitosis?
denis23 [38]

Answer:

b. Replicated chromosomes line up on the equatorial plate.

Explanation:

Mitosis starts with the breakdown of the nuclear envelop and condensation of chromatids into visible chromosomes. Since DNA replication has occurred during the S-phase of interphase, each chromosome has two sister chromatids held together by a centromere. A chromosome with two sister chromatids is said to be a replicated chromosome.

Metaphase of mitosis includes the alignment of replicated chromosomes at the cell's equator. The process is assisted by the spindle apparatus. This is followed by splitting of centromere and separation of sister chromatids during anaphase.

7 0
3 years ago
What do the ecosystems of a puddle, lake, river, jungle, mountain-top grassland, and deep-sea vent have in common?
Wewaii [24]
B. they are defined by their biotic factors and abiotic factors.
4 0
3 years ago
Why is earthquake prediction a challenge for scientists​
Amiraneli [1.4K]

Answer:

Reliable predictions require precursors – some kind of signal in the earth that indicates a big quake is on the way. The signal has to happen only before large earthquakes and it has to occur before all big quakes.

Explanation:

7 0
3 years ago
Other questions:
  • List some characteristics of matter.
    9·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • When you are frightened by something, what part of the brain directs your body to react by making your heart beat faster and inc
    5·1 answer
  • Reusable, complex proteins that promote chemical reactions within cells are called A) enzymes. B) inhibitors. C) regulators. D)
    6·2 answers
  • Heeeeeelp!!!!!!!!!!!!!!
    5·1 answer
  • In the table below, fill in the missing cause and effect of two examples of competition in a community.
    8·1 answer
  • Three factors that make up abiotic environment of tropical rainforest
    5·1 answer
  • HELP PLS ITS A TEST N I NEED HELP ASAP
    5·1 answer
  • I will give brainlist
    9·1 answer
  • Circle the class type of rock that most likely includes rock layers
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!