1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tia_tia [17]
3 years ago
11

In what year did Robert Hooke found that cork was full of tiny chambers?

Biology
1 answer:
Dafna11 [192]3 years ago
6 0

Robert Hooke found that cork was full of tiny chambers in the year 1665

You might be interested in
How does the genetic code of a eukaryote organism compare to that of a prokaryote organism?
frosja888 [35]

Answer:

— Eukaryotic gene expression occurs in both the nucleus and cytoplasm.

— Prokaryotic gene expression occurs within the cytoplasm of a cell due to the lack of a defined nucleus

5 0
3 years ago
Some mammals help maintain their body temperature by sweating when their bodies rise in temperature. Which property of water is
marshall27 [118]

Answer:

Water absorbs heat by breaking hydrogen bonds.

Explanation:

Specific heat is the amount of heat that must be absorbed or lost for 1 gram of that substance to change its temperature by 1 degree. As someone works out, their body releases sweat to keep their body from overheating. Specific heat it mentions that hydrogen bonds between water molecules require heat to form and break, which is what happens when we sweat.

4 0
3 years ago
Insulin-dependent diabetics depend upon ____________ microorganisms to produce the human protein that they rely upon to uptake g
a_sh-v [17]
The answer to this is D.
7 0
3 years ago
Read 2 more answers
HELP *20 POINTS* <br> 8th grade science
Komok [63]

Answer:

pyroclastic flow is a fast moving current of hot gas and volcanic matter that flows along the ground away from a volcano at high velocities.

Hotspot is volcanic regions thought to be fed by underlying mantle that is anomalously hot compared with the surrounding mantle

caldera-a large volcanic crater, especially one formed by a major eruption leading to the collapse of the mouth of the volcano.

tephra-rock fragments and particles ejected by a volcanic eruption

epicenter-the central point of something, typically a difficult or unpleasant situation

fault-an extended break in a body of rock, marked by the relative displacement and discontinuity of strata on either side of a particular surface

surface waves- mechanical wave that propagates along the interface between differing media

body waves-A body wave is a seismic wave that moves through the interior of the earth, as opposed to surface waves that travel near the earth's surface. P and S waves are body waves.

sorry if this doesnt help

3 0
3 years ago
Does Minnesota, Finland, and Russia have the same climate biome?
Savatey [412]

Climate of Russia

This area of Russia is famous for its extreme climate with very cold winters, but warm to hot summers, although they tend to be short and wet. ... The north and northeastern areas around the Black Sea have milder winters, but frequent rainfall all the year round.

Climate of Finland

July temperatures in Finland average 13 to 17°C. February is usually Finland's coldest month, with temperatures averaging from - 22 to -3°C. In northern Finland, winter temperatures often drop as low as -30°C or even down to -50°C, sometimes with strong, cold easterly or northeasterly winds.

Climate of Minnesota

Minnesota has a continental climate, with hot summers and cold winters. ... Temperatures as low as −60 °F (−51 °C) have occurred during Minnesota winters. Spring is a time of major transition in Minnesota.

7 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of the following hormones is released by the anterior pituitary as a part of that positive feedback loop between it and th
    12·1 answer
  • Which is one quality of the entire open-ocean zone?
    12·1 answer
  • A cross between a chicken and a turkey called turkins are raised on some farms in Wyoming. A Turkin is an example of _____.
    13·2 answers
  • Someone please help I'm so lost :(
    5·1 answer
  • Plsssss I need help with this taxonomic key. I have been posting this for hours and I'm super stuck plssss help
    6·1 answer
  • True/False: Plant Viruses can only infect plant cells
    10·2 answers
  • Which of the following correctly describes the process of DNA replication in the lagging strand?
    15·2 answers
  • PLEASE HELP ME I CANT FAIL FINALS THIS YEAR<br> - state if true or false
    5·1 answer
  • Answer quickly please
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!