1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
leonid [27]
3 years ago
9

Which of the following cycles does not involve living organisms?

Biology
2 answers:
MakcuM [25]3 years ago
5 0

Answer:

c

Explanation:

rocks have no living life force in there cycle

valentinak56 [21]3 years ago
4 0

Answer:

C

Explanation:

Because rocks are not living things

You might be interested in
What do cells and tissue look like?
Nitella [24]

Answer:

The first and 2nd pictures basically capture what they look like.

3 0
3 years ago
Rainforests around the world are being cleared at an alarming rate to make room for new communities, agriculture, mining, and ro
Kamila [148]

Answer:

(1) by increasing carbon dioxide and decreases oxygen

6 0
3 years ago
Euglena use which structure for movement? A. cilia B. flagella C. pseudopods D. they do not move
Harman [31]
The answer is B, a euglena uses a flagella in order to move. Euglena is a one celled organism under the Kingdom Protista. A flagella (or flagellum plural) is a long strand like structure that is located in the front end part (more like a tail in front). It flips to the left and right in order for the organism to move. It is connected to the reservoir, which contains the storage of food for the organism.



8 0
3 years ago
Read 2 more answers
What is the benefit of a scientific name vs. a common name?
Rus_ich [418]

Answer:

A scientific name is used around the world so there will be no confusion identifying the organism but common names vary from place to place.

Explanation:

I just know this stuff

8 0
3 years ago
Read 2 more answers
Anna is working on the study guide for her biology semester exam. The statement is made that ATP is required for ALL cellular fu
anyanavicka [17]

Answer:

are there options

Explanation:

8 0
3 years ago
Other questions:
  • What is the cell theory considered a scientific theory​
    5·1 answer
  • What are the three domains into which all living organisms are placed?
    8·1 answer
  • What equation shows a disaccharide with the monosaccharides that make it up
    12·1 answer
  • Air contains 78 percent, nitrogen 21 percent oxygen, and one percent argon. Which gas is the solvent?
    15·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Thermal Energy occurs when you combine these two things....
    6·1 answer
  • When moving up the food chain or pyramid what happens to the energy
    10·1 answer
  • Why might a nymph have a diet more like that of an adult than does a larva? SAMPLE RESPONSE WHOEVER ANSWERS CORRECTLY GETS BLAIN
    15·2 answers
  • True or False. Anything that has molecules doesn’t have heat. Explain your answer.
    8·2 answers
  • Help me please I need to pass to be able to play <br> Earth and space btw
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!