The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.
This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3' </span><span>the direction (--->)
3' ..</span>aatcg........................ 5' the direction (<---)
adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).
Answer:
hi, here's the answer of your question
Tighten bolts on your engine to prevent oil leaks.
Replace cracked or worn hydraulic lines and fittings before they fail.
Outfit your engine with an oil tray or drip pan.
Create your own bilge sock out of oil absorbent pads to prevent oily water discharge.
hope this was helpful...
<em>pls mark this as the brainliest answer...</em>
Answer: The answer should be 46 chromosomes.
Explanation:
Answer: B. Invasive species
An invasive species is a species of organisms which is introduced to a new ecosystem and increases in number rapidly. An invasive species complete with the native species for resources and the population of native species being weaker decreases in number, migrate to other locations or extinct. Here, foreign plants can be considered as invasive species because it limited the growth of native species and these foreign plants were only plants left after several growing seasons.
Answer:
While humans, as well as other vertebrates, have a closed blood circulatory system (meaning that the blood never leaves the network of arteries, veins and capillaries), some invertebrate groups have an open circulatory system containing a heart but limited blood vessels.
Explanation:
