1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastaziya [24]
4 years ago
13

What process reshuffles allele combinations between homologous chromosomes?

Biology
2 answers:
Thepotemich [5.8K]4 years ago
3 0

Answer:

a. genetic recombination

Explanation:

During meiosis, homologous chromosomes synapse in the zygotene stage of prophase-I of meiosis-I. During pachytene of prophase-I, these paired homologous chromosomes exchange some genetic segment between their non-sister chromatids. This process of genetic recombination between the homologous chromosomes is called crossing over. Genetic recombination gives rise to recombinant chromatids. These recombinant chromatids carry some new allelic combinations which were otherwise not present in the parental chromatids.

Fofino [41]4 years ago
3 0

Answer: Option A.

It is called Genetic recombination.

Explanation:

Genetic recombination is a genetic process by which alleles from different parent organisms are combined and reshuffles in the offsprings produced by the parent organisms and the alleles are entirely different from the parents. Genetic recombination occur when two DNA molecules exchange genetic materials with each other and this normally occur during meiosis.

You might be interested in
Which form of precipitation is likely to occur when a layer of air with temperatures above freezing overlies a subfreezing layer
Olin [163]

the answer is SLEET hope it helps :)


7 0
4 years ago
Read 2 more answers
What are genes? How are they related to traits?
masya89 [10]

Answer:

a gene is a unit of DNA that is usually located on a chromosome, they carry information that determine the traits, traits are characteristics inherited from your parents.

Explanation:

7 0
4 years ago
Read 2 more answers
Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG
k0ka [10]

Answer:

TTAACGCTAGCGAGCATGGCC

Explanation:

A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.

7 0
4 years ago
What type of cell is prepared to live on its own?
creativ13 [48]

Answer: A unicellular

Explanation: The entire body is unicellular therefore it can live on it's own

3 0
3 years ago
Read 2 more answers
The level of ecologic organization that incorporates abiotic factors is the
aleksandr82 [10.1K]
I believe it is biosphear<span />
8 0
3 years ago
Other questions:
  • What is removed to form a peptide bond between two amino acids?
    8·1 answer
  • Diffusion, osmosis, active transport. All of these are methods by which a cell
    10·2 answers
  • The fundamental resolution of an optical instrument is set by
    6·2 answers
  • Define 4 properties that scientists use to predict population sizes
    15·1 answer
  • What would be the expected effect on plants if the atmospheric CO2 concentration was doubled? What would be the expected effect
    12·1 answer
  • An allele that expresses itself in a heterozygote is a(n)
    9·1 answer
  • 7. In which direction does water move through a plant?
    7·2 answers
  • Using the following vocab words, write them in order of smallest to largest level
    6·2 answers
  • Match the type of ELISA with what it is used to detect. Question 2 options: detects presences and concentration of antigen/prote
    14·1 answer
  • Question 4 (3 points)
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!