Using a microscope
Explanation:
A microscope is a scientific device used for magnifying and studying very tiny features.
It was invented by Anton Von Leeuwenhoek in the 17th century.
- A unicellular organism is an organism made up of a single cell.
- A multi-cellular organism is made up of several cells.
- A cell is a very small microscopic structure.
- It is usually described as the fundamental unit of life.
- Due to its small size, the naked eyes cannot see it
- The invention of the microscope opened up the world of cells.
- Since they have been around for a long time, distinction of cells would have been made possible at those times using a microscope.
learn more:
Microscope brainly.com/question/4065308
#learnwithBrainly
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
B = hydrogen bonding
Explanation:
The water molecule consist of two hydrogen atom one oxygen atom. There is large electronegativity difference between oxygen and hydrogen. Both atoms are bonded through covalent bonds.
Covalent bond:
It is formed by the sharing of electron pair between bonded atoms.
The atom with larger electronegativity attract the electron pair more towards it self and becomes partial negative while the other atom becomes partial positive.
For example:
In water the electronegativity of oxygen is 3.44 and hydrogen is 2.2. That's why electron pair attracted more towards oxygen, thus oxygen becomes partial negative and hydrogen becomes partial negative. The partial positive end of one water molecule attracted towards the partial negative end of other moleucle. The attraction between them is called hydrogen bonding. In this way large mole are connected with each other. Hydrogen bonding is actually a weak bonding.
When the population is large and dense.
Hope this helps:)
Answer: The fight-or-flight response is most clearly associated with the release of epinephrine into the bloodstream.
Any physiological reaction occurring due to something which frightens physically or mentally is fight-or-flight response. In order to produce the fight-or-flight response the hypothalamus activation of the adrenal cortical system and sympathetic nervous system takes place. On receiving the signal from hypothalamus the sympathetic nervous system makes the actions of body speed up or gets tensed and body is in an alert condition.
The impulses are sent by the sympathetic nervous system to the smooth muscles and also glands. As a response to it epinephrine or adrenaline and the norepinephrine or noradrenaline is released by the adrenal medulla in the bloodstream. These stress hormones thus bring about changes in the body such as increase in blood pressure and heart rate.
