Produces lightning in a thunderstorm

Biology

2 answers:

balandron [24]3 years ago

8 0

Answer:

Lightning is an electric current. Within a thundercloud way up in the sky, many small bits of ice (frozen raindrops) bump into each other as they move around in the air. All of those collisions create an electric charge. After a while, the whole cloud fills up with electrical charges.

vesna_86 [32]3 years ago

5 0

Answer:

Explanation:

You might be interested in

What different natural disasters affect the population

Leviafan [203]

There are many different natural disasters that affect the population, including hurricanes, tornados, earthquakes, tsunamis, floods, flash floods, and fires. Hope this helps! :)

5 0

3 years ago

Why isn't England as cold as NE Canada, even though they are found at the same latitude?

svetoff [14.1K]

Answer:because when the land is colder then the water,some of the heat from the is water transferred in to the air,it carries warm water from Florida over to England I believe.

Explanation:

8 0

3 years ago

Read 2 more answers

A drug company is testing the effectiveness of a new blood pressure medicine using rats at the test subject describe the experim

labwork [276]

1.Medicine
2.Placebo

5 0

3 years ago

Help I'm confused!

aev [14]

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

7 0

3 years ago

Smooth ER is used as an intercellular Highway and as a storage area for proteins. What other function does Smooth ER have?

lions [1.4K]

Answer:

It makes lipids, phospholipids as in plasma membranes, and steroids.

Explanation:

6 0

3 years ago